Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EMU005531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGGGATTGCACCCATAATCTGGGCTGAATCATGAAAGGGTGTTCCTCTTATCTAATGTACTCCTTTGGGGGACTTTTGTCCCTATGGATTCTTCTGGTGTCTTCCACAAACCAATGCACTGTGAGATACAACGTAGCTGACTGCAGCCATTTGAAGCTAACACACATACCTGATGATCTTCCCTCTAACATAACAGTGTTGAATCTTACTCACAACCAACTCAGAAGATTACCACCTACCAACTTTACAAGATACAGCCAACTTGCTATCTTGGATGCAGGATTTAACTCCATTTCAAAACTGGAGCCAGAACTGTGCCAAATACTCCCTTTGTTGAAAGTATTGAACCTGCAACATAATGAGCTCTCTCAGATTTCTGATCAAACCTTTGTCTTCTGCACGAACCTG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000031639

numer dostępu NCBI

NM_126166

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... TLR3(142980) , Tlr3(142980)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
K Mori et al.
Journal of dental research, 94(8), 1149-1157 (2015-06-06)
Damage-associated molecular patterns (DAMPs), endogenous molecules released from injured or dying cells, evoke sterile inflammation that is not induced by microbial pathogens. Periodontal diseases are infectious diseases caused by oral microorganisms; however, in some circumstances, DAMPs might initiate inflammatory responses
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
A I Kajita et al.
The Journal of investigative dermatology, 135(8), 2005-2011 (2015-03-31)
Toll-like receptors (TLRs) recognize specific microbial products in the innate immune response. TLR3, a double-stranded RNA sensor, is thought to have an important role in viral infections, but the regulation of TLR3 expression and its function in keratinocytes are not

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej