Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU161041

Sigma-Aldrich

MISSION® esiRNA

targeting human GPBAR1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCGGGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACTGGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATGGGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGGGAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCTGGACTTGAACTAAAGGAAGGGCCTCTGCTGACTCCTACCAGAGCATCCGTCCAGCTCAGCCATCCAGCCTGTCTCTACC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000179921

numer dostępu NCBI

NM_001077191

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GPBAR1(151306) , GPBAR1(151306)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hui Liang et al.
Journal of neuroinflammation, 18(1), 40-40 (2021-02-04)
Nucleotide-binding oligomerization domain-like receptor pyrin domain-containing protein 3 (NLRP3) plays an important role in mediating inflammatory responses during ischemic stroke. Bile acid receptor Takeda-G-protein-receptor-5 (TGR5) has been identified as an important component in regulating brain inflammatory responses. In this study
Ai-Di Li et al.
Experimental cell research, 389(2), 111855-111855 (2020-01-25)
Takeda-G-protein-receptor-5 (TGR5) is a G-protein-coupled receptor (GPCR) activated by bile acids, and mortalin is a multipotent chaperone of the HSP70 family. In the present study, TGR5 was detected by immunohistochemistry (IHC) in extrahepatic cholangiocarcinoma (ECC) specimens, and TGR5 expression in
You-Chao Qi et al.
Chinese journal of natural medicines, 18(12), 898-906 (2020-12-29)
Taurochenodeoxycholic acid (TCDCA) is one of the main effective components of bile acid, playing critical roles in apoptosis and immune responses through the TGR5 receptor. In this study, we reveal the interaction between TCDCA and TGR5 receptor in TGR5-knockdown H1299
Yu Chen et al.
International immunopharmacology, 71, 144-154 (2019-03-23)
NLRP3 inflammasome has been reported to be associated with inflammatory bowel disease including colitis due to its potential ability to induce IL-1β secretion. Emerging studies have demonstrated that Genistein, a major isoflavone, has potential anti-inflammatory effects in murine model colitis.
Haiming Xiao et al.
Pharmacological research, 151, 104559-104559 (2019-11-24)
Our previous studies indicated that the G-protein-coupled bile acid receptor, Gpbar1 (TGR5), inhibits inflammation by inhibiting the NF-κB signalling pathway, eventually attenuating diabetic nephropathy (DN). Gentiopicroside (GPS), the main active secoiridoid glycoside of Gentiana manshurica Kitagawa, has been demonstrated to
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej