Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU156721

Sigma-Aldrich

MISSION® esiRNA

targeting human ECM1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCTTTGAGGGACAGAGTCAAGTGCAGCCCCCTCCCTCTCAGGAGGCCACCCCTCTCCAACAGGAAAAGCTGCTACCTGCCCAACTCCCTGCTGAAAAGGAAGTGGGTCCCCCTCTCCCTCAGGAAGCTGTCCCCCTCCAAAAAGAGCTGCCCTCTCTCCAGCACCCCAATGAACAGAAGGAAGGAACGCCAGCTCCATTTGGGGACCAGAGCCATCCAGAACCTGAGTCCTGGAATGCAGCCCAGCACTGCCAACAGGACCGGTCCCAAGGGGGCTGGGGCCACCGGCTGGATGGCTTCCCCCCTGGGCGGCCTTCTCCAGACAATCTGAACCAAATCTGCCTTCCTAACCGTCAGCATGTGGTATATGGTCCCTGGAACCTACCACAGTCCAGCTACTCCCACCTCACTCGCCAGGGTGAGACCCTCAATTTCCTGGAGATTGGATATTCCCGCTGCTGCCACTGCCGCAGCCACACAAACCGCCTAGAGT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000143369

numer dostępu NCBI

NM_022664

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ECM1(1893) , ECM1(1893)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Cuixian Li et al.
PloS one, 6(10), e27053-e27053 (2011-11-03)
Malignant gliomas represent one of the most aggressive types of cancers and their recurrence is closely linked to acquired therapeutic resistance. A combination of chemotherapy is considered a promising therapeutic model in overcoming therapeutic resistance and enhancing treatment efficacy. Herein
Lin-Qing Liu et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 133, 110779-110779 (2019-09-01)
MicroRNAs were known to play very important roles in human diseases, and have attracted great interests of research scientists in medicine, toxicology and functional foods. Gastric carcinoma (GC) remains one of the most common and lethal types of malignancy worldwide.
Sophie Sarah Steinhaeuser et al.
Laboratory investigation; a journal of technical methods and pathology, 100(7), 928-944 (2020-03-24)
The tumor microenvironment is increasingly recognized as key player in cancer progression. Investigating heterotypic interactions between cancer cells and their microenvironment is important for understanding how specific cell types support cancer. Forming the vasculature, endothelial cells (ECs) are a prominent
Jie Chen et al.
Oncogene, 38(14), 2533-2550 (2018-12-12)
Many reports have described DGKα as an oncogene, hence, we investigated its function and the underlying mechanisms in esophageal squamous cell carcinoma (ESCC) progression. This study demonstrated that DGKα was upregulated by inflammatory stimulants and formed feedforward loop with Akt/NF-κB
Ariel E Cariaga-Martínez et al.
Biology open, 3(10), 924-936 (2014-09-14)
The acquisition of invasiveness is characteristic of tumor progression. Numerous genetic changes are associated with metastasis, but the mechanism by which a cell becomes invasive remains unclear. Expression of p85β, a regulatory subunit of phosphoinositide-3-kinase, markedly increases in advanced carcinoma

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej