Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU156191

Sigma-Aldrich

MISSION® esiRNA

targeting human TM4SF1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAAAAGAACCAACCCAGGACAGAGCCACAATCTTCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000169908

numer dostępu NCBI

NM_014220

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TM4SF1(4071) , TM4SF1(4071)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yu-Cheng Su et al.
mAbs, 6(4), 1069-1083 (2014-05-31)
Modification of antibody class and binding properties typically requires cloning of antibody genes, antibody library construction, phage or yeast display and recombinant antibody expression. Here, we describe an alternative "cloning-free" approach to generate antibodies with altered antigen-binding and heavy chain
Young Ran Park et al.
International journal of oncology, 48(5), 2135-2143 (2016-03-18)
Transmembrane-4-L6 family 1 (TM4SF1) is upregulated in colorectal carcinoma (CRC). However, the mechanism leading to inhibition of the TM4SF1 is not known. In the present study, we investigated the regulation of TM4SF1 and function of microRNAs (miRNAs) in CRC invasion
Dong Xu et al.
Cancer biology & therapy, 21(4), 354-363 (2020-01-08)
Background: Transmembrane-4-L-six-family-1 (TM4SF1) functions to regulate cell growth and mobility and TM4SF1 expression was upregulated in pancreatic cancer. This study further investigated the role of TM4SF1 in regulating pancreatic cancer epithelial-mesenchymal transition (EMT) and angiogenesis and the underlying molecular events.Methods:
Yonghoon Kwon et al.
PloS one, 9(9), e108771-e108771 (2014-09-25)
5' AMP-activated protein kinase (AMPK) is a highly conserved serine-threonine kinase that regulates energy expenditure by activating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. Therefore AMPK activators are considered to be drug targets for treatment of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej