Przejdź do zawartości
Merck

EHU145431

Sigma-Aldrich

MISSION® esiRNA

targeting human AICDA

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATTGCTCTTCCTCCGCTACATCTCGGACTGGGACCTAGACCCTGGCCGCTGCTACCGCGTCACCTGGTTCACCTCCTGGAGCCCCTGCTACGACTGTGCCCGACATGTGGCCGACTTTCTGCGAGGGAACCCCAACCTCAGTCTGAGGATCTTCACCGCGCGCCTCTACTTCTGTGAGGACCGCAAGGCTGAGCCCGAGGGGCTGCGGCGGCTGCACCGCGCCGGGGTGCAAATAGCCATCATGACCTTCAAAGATTATTTTTACTGCTGGAATACTTTTGTAGAAAACCACGAAAGAACTTTCAAAGCCTGGGAAGGGCTGCATGAAAATTCAGTTCGTCTCTCCAGACAGCTTCGGCGCATCCTTTTGCCCCTGTATGAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xudong Ao et al.
Cytotechnology, 68(6), 2637-2648 (2016-08-11)
DNA methylation in mammals is an epigenetic marker and necessary for normal embryogenesis. The global genomic demethylation of 5-methylcytosine occurs during the first cell cycle following fertilization. Activation-induced cytidine deaminase (AID), which is well-known for the function in antibody diversification
Grant Godsmark et al.
Anticancer research, 41(1), 237-247 (2021-01-10)
Activation-induced cytidine deaminase (AID) is a DNA modifying enzyme which has an essential function in promoting antibody diversification. Its overexpression is strongly associated with B-cell derived malignancies including Burkitt lymphoma, where AID is required for the characteristic c-MYC/IGH translocation. This
Yugo Sawai et al.
Cancer research, 75(16), 3292-3301 (2015-06-27)
Pancreatic ductal adenocarcinoma (PDAC) develops via an accumulation of various gene mutations. The mechanism underlying the mutations in PDAC development, however, is not fully understood. Recent insight into the close association between the mutation pattern of various cancers and specific

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej