Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU138681

Sigma-Aldrich

MISSION® esiRNA

targeting human MYOG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCTACAGATGCCCACAACCTGCACTCCCTCACCTCCATCGTGGACAGCATCACAGTGGAAGATGTGTCTGTGGCCTTCCCAGATGAAACCATGCCCAACTGAGATTGTCTTCCAAGCCGGGCATCCTTGCGAGCCCCCCAAGCTGGCCACAGATGCCACTACTTCTGTAGCAGGGGCCTCCTAAGCCAGGCTGCCCTGATGCTAGGAAGCCAGCTCTGGGGTGCCATAGGCCAGACTATCCCCTTCCTCATCCATGTAAGGTTAACCCACCCCCCAGCAAGGGACTGGACGCCCTCATTCAGCTGCCTCCTTAGAGGAGAGGGCATCCCCTTTCCAGGGAGGTAAAGCAGGGGACCAGAGCGCCCCCTCGTGTATGCCCCAGCTCAGGGGGCAAACTCAGGAGCTTCCTTTTTATCATAACGCGGCCTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000122180

numer dostępu NCBI

NM_002479

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MYOG(4656) , MYOG(4656)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Chi Yan et al.
International journal of molecular sciences, 16(10), 25014-25030 (2015-10-23)
Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of
Adeel Malik et al.
PloS one, 10(7), e0133597-e0133597 (2015-07-23)
Muscle, a multinucleate syncytium formed by the fusion of mononuclear myoblasts, arises from quiescent progenitors (satellite cells) via activation of muscle-specific transcription factors (MyoD, Myf5, myogenin: MYOG, and MRF4). Subsequent to a decline in Pax7, induction in the expression of
Zhihui Liu et al.
Nature communications, 11(1), 911-911 (2020-02-16)
Embryonal rhabdomyosarcoma (ERMS) is a childhood cancer that expresses myogenic master regulatory factor MYOD but fails to differentiate. Here, we show that the zinc finger transcription factor CASZ1 up-regulates MYOD signature genes and induces skeletal muscle differentiation in normal myoblasts
Sae-Won Lee et al.
Scientific reports, 5, 16523-16523 (2015-11-14)
Skeletal muscle regeneration occurs continuously to repair muscle damage incurred during normal activity and in chronic disease or injury. Herein, we report that A-kinase anchoring protein 6 (AKAP6) is important for skeletal myoblast differentiation and muscle regeneration. Compared with unstimulated
Majid Rasool Kamli et al.
Biochemical and biophysical research communications, 450(4), 1291-1296 (2014-07-06)
Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej