Przejdź do zawartości
Merck

EHU092331

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (1)

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTTTGTGAAACTTGAAAGAGAATAGACAGTATGACATATAGAATTAATACAAAACAGTTTAACAACCATTTAACTGCAGTGTAAGAAAATTGGACTGTAATCATATCGCTACTGGCATCTGTTATCTAGTATGCATTTCTGGTGTGTATCTGAAAGGAAGACATTTTCTACCCTAGATCCAATTGCATTTATTTATCAATAAGTGCCATTAAATTGAAATTATATTACATTTTACACTTTCTCAATGAATGAACAAATTAGTCTGTAGAATCTAGCCACCTGTTTAGCCTAGTCATGTGCCTTGAACATATATGTGTCCCATAATCTGGCTCATGGTACCTGTTCTTCTATCCAAACCTTTCAATTCATGCTACCTGATTCATTTATTTGACATAGATCT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Praneeth Chitirala et al.
Frontiers in immunology, 10, 1855-1855 (2019-08-27)
Cytotoxic T lymphocytes kill infected or malignant cells through the directed release of cytotoxic substances at the site of target cell contact, the immunological synapse. While genetic association studies of genes predisposing to early-onset life-threatening hemophagocytic lymphohistiocytosis has identified components
Juan José Saez et al.
Cells, 10(2) (2021-02-13)
LAT is an important player of the signaling cascade induced by TCR activation. This adapter molecule is present at the plasma membrane of T lymphocytes and more abundantly in intracellular compartments. Upon T cell activation the intracellular pool of LAT
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej