Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU090781

Sigma-Aldrich

MISSION® esiRNA

targeting human MECOM (1)

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCATAGATGCCAGTCAACCAGATGTTGGAAGCTGGCTCAAGTACATTAGATTCGCTGGCTGTTATGATCAGCACAACCTTGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTTCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACTATGGCGCCGGATATCCACGAAGAACGGCAATATCGCTGCGAAGACTGTGACCAGCTCTTTGAATCTAAGGCTGAACTAGCAGATCACCAAAAGTTTCCATGCAGTACTCCTCACTCAGCATTTTCAATGGTTGAAGAGGACTTTCAGCAAAAACTCGAAAGCGAGAATGATCTCCAAGAGATACACACGATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000085276

numer dostępu NCBI

NM_005241

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MECOM(2122) , EVI1(2122)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Lai-Sheung Chan et al.
International journal of molecular sciences, 21(15) (2020-08-06)
The Wnt signaling pathway is one of the major signaling pathways used by cancer stem cells (CSC). Ecotropic Viral Integration Site 1 (EVI1) has recently been shown to regulate oncogenic development of tumor cells by interacting with multiple signaling pathways
Anjan Kumar Pradhan et al.
PloS one, 6(9), e25370-e25370 (2011-10-08)
EVI1 (Ecotropic Viral Integration site I), which was originally identified as a myeloid transforming gene by means of retroviral insertional mutagenesis in mouse leukemia, encodes a nuclear DNA binding zinc finger protein. The presence of zinc fingers that are able
Gerwin Heller et al.
Journal of hematology & oncology, 8, 28-28 (2015-04-18)
The transcription factor Ecotropic Virus Integration site 1 (EVI1) regulates cellular proliferation, differentiation, and apoptosis, and its overexpression contributes to an aggressive course of disease in myeloid leukemias and other malignancies. Notwithstanding, knowledge about the target genes mediating its biological
F Mateo et al.
Oncogene, 36(19), 2737-2749 (2016-12-20)
Inhibitors of the mechanistic target of rapamycin (mTOR) are currently used to treat advanced metastatic breast cancer. However, whether an aggressive phenotype is sustained through adaptation or resistance to mTOR inhibition remains unknown. Here, complementary studies in human tumors, cancer

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej