Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU081611

Sigma-Aldrich

MISSION® esiRNA

targeting human MYH9

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCTGGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCACAAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTGGAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTCATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTTTTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTATTATCTCCTGTCTGGGGCTGGAGAGCACCTGAAGACC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Satyendra Kumar Singh et al.
Medical oncology (Northwood, London, England), 37(10), 88-88 (2020-09-10)
Non-muscle myosin IIA heavy chain (MYH9) has been implicated in many physiological and pathological functions including cell adhesion, polarity, motility to cancer. However, its role in melanoma remains unexplored. The aim of our study was to evaluate the role of
Shuli Liang et al.
PloS one, 6(4), e18409-e18409 (2011-05-03)
MicroRNAs (miRNAs) are important regulators that play key roles in tumorigenesis and tumor progression. A previous report has shown that let-7 family members can act as tumor suppressors in many cancers. Through miRNA array, we found that let-7f was downregulated
Bo Yang et al.
Nature materials, 19(2), 239-250 (2019-10-30)
A common feature of cancer cells is the alteration of kinases and biochemical signalling pathways enabling transformed growth on soft matrices, whereas cytoskeletal protein alterations are thought to be a secondary issue. However, we report here that cancer cells from
Jeong Suk Kang et al.
Scientific reports, 9(1), 7679-7679 (2019-05-24)
MYH9, a widely expressed gene encoding nonmuscle myosin heavy chain, is also expressed in podocytes and is associated with glomerular pathophysiology. However, the mechanisms underlying MYH9-related glomerular diseases associated with proteinuria are poorly understood. Therefore, we investigated the role and
Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej