Przejdź do zawartości
Merck

EHU076591

Sigma-Aldrich

MISSION® esiRNA

targeting human ROBO1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGATGGAGTCCTCGTTTCAACCCAAGACTCTCGAATCAAACAGTTGGAGAATGGAGTACTGCAGATCCGATATGCTAAGCTGGGTGATACTGGTCGGTACACCTGCATTGCATCAACCCCCAGTGGTGAAGCAACATGGAGTGCTTACATTGAAGTTCAAGAATTTGGAGTTCCAGTTCAGCCTCCAAGACCTACTGACCCAAATTTAATCCCTAGTGCCCCATCAAAACCTGAAGTGACAGATGTCAGCAGAAATACAGTCACATTATCGTGGCAACCAAATTTGAATTCAGGAGCAACTCCAACATCTTATATTATAGAAGCCTTCAGCCATGCATCTGGTAGCAGCTGGCAGACCGTAGCAGAGAATGTGAAAACAGAAACATCTGCCATTAAAGGACTCAAACCTAATGCAATTTACCTTTTCCTTGTGAGGGCAGCTAAT

Ensembl | numer dostępu dla gatunku człowiek

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zongpu Zhang et al.
Aging, 13(4), 5055-5068 (2021-02-04)
Vasculogenic mimicry (VM), the formation of an alternative microvascular circulation independent of VEGF-driven angiogenesis, is reluctant to anti-angiogenesis therapy for glioma patients. However, treatments targeting VM are lacking due to the poor understanding of the molecular mechanism involved in VM
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej