Przejdź do zawartości
Merck

EHU060131

Sigma-Aldrich

MISSION® esiRNA

targeting human IL17RB

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGGATGCCACTGCTTTCTGTGCAGAACTTCTCCATGTCAAGCAGCAGGTGTCAGCAGGAAAAAGATCACAAGCCTGCCACGATGGCTGCTGCTCCTTGTAGCCCACCCATGAGAAGCAAGAGACCTTAAAGGCTTCCTATCCCACCAATTACAGGGAAAAAACGTGTGATGATCCTGAAGCTTACTATGCAGCCTACAAACAGCCTTAGTAATTAAAACATTTTATACCAATAAAATTTTCAAATATTGCTAACTAATGTAGCATTAACTAACGATTGGAAACTACATTTACAACTTCAAAGCTGTTTTATACATAGAAATCAATTACAGTTTTAATTGAAAACTATAACCATTTTGATAATGCAACAATAAAGCATCTTCAGCCAAACATCTAGTCTTCCATAGACCATGCATTGCAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yong-Sheng Teng et al.
Cell death & disease, 10(2), 79-79 (2019-01-30)
Interleukin-17 receptor B (IL-17RB), a member of the IL-17 receptor family activated by IL-17B/IL-17E, has been shown to be involved in inflammatory diseases. However, the regulation and function of IL-17RB in Helicobacter pylori (H. pylori) infection, especially in the early-phase
Suxun Pan et al.
Cell biology international, 44(11), 2220-2230 (2020-07-28)
Interleukin-25 (IL-25) has been recognized as a new member of the IL-17 family and implicated in various inflammatory pathology. We aimed to investigate the effects of IL-25 on the expression of matrix metalloproteinase-2 (MMP-2), MMP-8, and MMP-9 in periodontal fibroblast
Lei Ren et al.
Molecular immunology, 90, 126-135 (2017-07-18)
IL-17RB, a member of the IL-17 receptor family that can be activated by IL-17B, has been proved to be involved in inflammatory diseases and cancers. However, the function of IL-17RB in thyroid cancer is still unknown. In this study, IL-17RB

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej