Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU057101

Sigma-Aldrich

MISSION® esiRNA

targeting human PINK1, PINK1-AS

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGGAGTGTGAAACGCTCTGCCAGGCAGCCCTCCTCCTCTGCTCATGGAGGGCAGCCCTGTGATGTCCCTGCATGGAGCTGGTGAATTACTAAAAGAACATGGCATCCTCTGTGTCGTGATGGTCTGTGAATGGTGAGGGTGGGAGTCAGGAGACAAGACAGCGCAGAGAGGGCTGGTTAGCCGGAAAAGGCCTCGGGCTTGGCAAATGGAAGAACTTGAGTGAGAGTTCAGTCTGCAGTCCTCTGCTCACAGACATCTGAAAAGTGAATGGCCAAGCTGGTCTAGTAGATGAGGCTGGACTGAGGAGGGGTAGGCCTGCATCCACAGAGAGGATCCAGGCCAAGGCACTGGCTGTCAGTGGCAGAGTTTGGCTGTGACCTTTGCCCCTAACACGAGGAACTCGTTTGAAGGGGGCAGCGTAGCATGTCTGATTTGCCACCTGGAT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Rachel M Furlong et al.
Neuroscience letters, 720, 134777-134777 (2020-01-25)
Accumulation of α-synuclein is a pathological hallmark of Parkinson's disease (PD) and has been linked to reductions in neurite length and axonal degeneration of midbrain dopaminergic neurons. Mutations in SNCA, which encodes α-synuclein, and loss of function mutations in PTEN-induced putative
Yan Gao et al.
Biochemical pharmacology, 177, 113997-113997 (2020-05-01)
Alzheimer's disease (AD) is an irreversible neurodegenerative brain disorder with complex pathogenesis. The fibrillar peptide β-amyloid (Aβ) has a chief function in the pathogenesis of AD. Emerging evidence has indicated that there is a tight relationship between inflammation, mitochondrial dysfunction
Yuan Xu et al.
Molecular neurobiology, 56(1), 252-266 (2018-04-25)
There is emerging evidence suggesting that neurotoxic insults and hypoxic/ischemic injury are underlying causes of Parkinson's disease (PD). Since PTEN-induced kinase 1 (PINK1) dysfunction is involved in the molecular genesis of PD and since our recent studies have demonstrated that
C-N Yang et al.
International endodontic journal, 52(5), 676-688 (2018-12-12)
To assess the connection between mitophagy and hypoxia-induced apoptosis in osteoblasts and whether simvastatin alleviates bone resorption in apical periodontitis through modulation of mitophagy-related apoptosis. Hypoxia-induced generation of reactive oxygen species in mitochondria and changes in mitochondrial membrane potential were
Ruru Li et al.
Oxidative medicine and cellular longevity, 2019, 9341018-9341018 (2019-10-05)
Parkinson's disease (PD) is a common neurodegenerative disease characterized by the degeneration of nigrostriatal dopaminergic (DA) neurons. Our previous studies have suggested that salidroside (Sal) might play neuroprotective effects against PD by preserving mitochondrial Complex I activity. However, the exact

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej