Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU035471

Sigma-Aldrich

MISSION® esiRNA

targeting human PNPLA2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGTGCCAAGTTCATTGAGGTATCTAAAGAGGCCCGGAAGCGGTTCCTGGGCCCCCTGCACCCCTCCTTCAACCTGGTAAAGATCATCCGCAGTTTCCTGCTGAAGGTCCTGCCTGCTGATAGCCATGAGCATGCCAGTGGGCGCCTGGGCATCTCCCTGACCCGCGTGTCAGACGGCGAGAATGTCATTATATCCCACTTCAACTCCAAGGACGAGCTCATCCAGGCCAATGTCTGCAGCGGTTTCATCCCCGTGTACTGTGGGCTCATCCCTCCCTCCCTCCAGGGGGTGCGCTACGTGGATGGTGGCATTTCAGACAACCTGCCACTCTATGAGCTTAAGAACACCATCACAGTGTCCCCCTTCTCGGGCGAGAGTGACATCTGTCCGCAGGACAGCTCCACCAACATC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000177666

numer dostępu NCBI

NM_020376

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PNPLA2(57104) , PNPLA2(57104)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yosuke Kanno et al.
Arthritis research & therapy, 19(1), 22-22 (2017-02-06)
Systemic sclerosis (SSc) is a connective tissues disease of unknown origin characterized by vascular damage and extensive fibrosis. Recently, we demonstrated that α2-antiplasmin (α2AP) is associated with the development of fibrosis in SSc. We herein investigate the roles of α2AP
Monika Riederer et al.
Archives of physiology and biochemistry, 123(4), 249-253 (2017-04-04)
Vascular endothelial cells represent an important source of arachidonic acid (AA)-derived mediators involved in the generation of anti- or proatherogenic environments. Evidence emerged (in mast cells), that in addition to phospholipases, neutral lipid hydrolases as adipose triglyceride lipase (ATGL) also
Tian Ma et al.
International journal of oncology, 42(5), 1743-1753 (2013-04-03)
The G0/G1 switch gene 2 (G0S2) is rapidly induced by all-trans-retinoic acid (RA)-treatment of acute promyelocytic leukemia (APL) and other cells. G0S2 regulates lipolysis via inhibition of adipose triglyceride lipase (ATGL). This study found that retinoic acid receptor (RAR), but
Susanne Bürger et al.
International journal of molecular sciences, 22(1) (2021-01-06)
The demise of retinal ganglion cells (RGCs) is characteristic of diseases of the retina such as glaucoma and diabetic or ischemic retinopathies. Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein that mediates neuroprotection and inhibition of angiogenesis in the
Ping Xie et al.
Endocrinology, 156(5), 1648-1658 (2015-03-10)
Intramyocellular accumulation of lipids is often associated with insulin resistance. Deficiency of comparative gene identification-58 (CGI-58) causes cytosolic deposition of triglyceride (TG)-rich lipid droplets in most cell types, including muscle due to defective TG hydrolysis. It was unclear, however, whether
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej