Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU032931

Sigma-Aldrich

MISSION® esiRNA

targeting human P4HB

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000185624

numer dostępu NCBI

NM_000918

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... P4HB(5034) , P4HB(5034)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Rashed Alhammad et al.
Oncology reports, 44(6), 2406-2418 (2020-10-31)
Oxidoreductase protein disulphide isomerases (PDI) are involved in the regulation of a variety of biological processes including the modulation of endoplasmic reticulum (ER) stress, unfolded protein response (UPR), ER‑mitochondria communication and the balance between pro‑survival and pro‑death pathways. In the
Yajing Liu et al.
Cancer research, 79(11), 2923-2932 (2019-04-19)
Patients with glioblastoma multiforme (GBM) survive on average 12 to 14 months after diagnosis despite surgical resection followed by radiotheraphy and temozolomide therapy. Intrinsic or acquired resistance to chemo- and radiotherapy is common and contributes to a high rate of
Xing Ma et al.
Oncology letters, 20(1), 257-265 (2020-06-23)
The aim of the present study was to investigate the role of prolyl 4-hydroxylase beta polypeptide (P4HB) in the chemoresistance of liver cancer. Drug-resistant liver cancer cell lines, such as HepG2/adriamycin (ADR) cells, were treated and screened using adriamycin. Gene
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Wei Xia et al.
Oncotarget, 8(5), 8512-8521 (2017-01-05)
P4HB and GRP78 are molecular chaperones involved in cellular response to ER stress. They have been linked to cancer progression; however, their roles in hepatocellular carcinoma (HCC) are largely unclear. In this study, we found that P4HB is overexpressed in

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej