Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU026681

Sigma-Aldrich

MISSION® esiRNA

targeting human TSPAN8

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCTCCAGAGCATATTGCAGGACAAGCCTGTAACGAATAGTTAAATTCACGGCATCTGGATTCCTAATCCTTTTCCGAAATGGCAGGTGTGAGTGCCTGTATAAAATATTCTATGTTTACCTTCAACTTCTTGTTCTGGCTATGTGGTATCTTGATCCTAGCATTAGCAATATGGGTACGAGTAAGCAATGACTCTCAAGCAATTTTTGGTTCTGAAGATGTAGGCTCTAGCTCCTACGTTGCTGTGGACATATTGATTGCTGTAGGTGCCATCATCATGATTCTGGGCTTCCTGGGATGCTGCGGTGCTATAAAAGAAAGTCGCTGCATGCTTCTGTTGTTTTTCATAGGCTTGCTTCTGATCCTGCTCCTGCAGGTGGCGACAGGTATCCTAGGAGCTGTTTTCAAATCTAAGTCTGATCGCATTGTGAATGAAACTCTCTATGAAAACACAAAGCTTTTGAGCGCCACAGGGGAAAGTGAAAAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000127324

numer dostępu NCBI

NM_004616

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TSPAN8(7103) , TSPAN8(7103)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Manale El Kharbili et al.
Oncotarget, 8(10), 17140-17155 (2017-02-12)
Melanoma is well known for its propensity for lethal metastasis and resistance to most current therapies. Tumor progression and drug resistance depend to a large extent on the interplay between tumor cells and the surrounding matrix. We previously identified Tetraspanin
Manale El Kharbili et al.
Oncogene, 38(20), 3781-3793 (2019-01-27)
Due to its high proclivity to metastasize, and despite the recent development of targeted and immune therapy strategies, melanoma is still the deadliest form of skin cancer. Therefore, understanding the molecular mechanisms underlying melanoma invasion remains crucial. We previously characterized
Lunshou Wei et al.
International journal of clinical and experimental medicine, 8(6), 8599-8607 (2015-08-27)
This study was designed to investigate the effects of Tetraspanin 8 (TSPAN8) overexpression and TSPAN8 suppression on gastric cancer cell proliferation and invasion. Furthermore, whether extracellular-signal regulated kinase (ERK) mitogen-activated protein kinase (MAPK) pathway was involved in TSPAN8's function on

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej