Przejdź do zawartości
Merck

EHU017161

Sigma-Aldrich

MISSION® esiRNA

targeting human PPP3CA

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAACAGTTCCTGTGTGTGCATGGTGGTTTGTCTCCAGAGATTAACACTTTAGATGATATCAGAAAATTAGACCGATTCAAAGAACCACCTGCATATGGACCTATGTGTGATATCCTGTGGTCAGACCCCCTGGAAGATTTTGGAAATGAGAAGACTCAGGAACATTTCACTCACAACACAGTCAGGGGGTGTTCATACTTCTACAGTTACCCGGCTGTATGTGAATTCTTACAGCACAATAACTTGTTATCTATACTCCGAGCCCACGAAGCCCAAGATGCAGGGTACCGCATGTACAGGAAAAGCCAAACAACAGGCTTCCCTTCTCTAATTACAATTTTTTCAGCACCAAATTACTTAGATGTATACAATAACAAAGCTGCAGTATTGAAGTATGAGAACAATGTTATGAATATCAGGCAATTCAACTGTTCTCCTCATCCATACTGGCTTCCAAATTTCATGGATGTTTTTACTTGGTCCCTTCCATTTGTTGGGGAAAAAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Junfen Xu et al.
Molecular therapy. Nucleic acids, 22, 1176-1190 (2020-12-15)
Circular RNAs (circRNAs) function as efficient microRNA (miRNA) sponges that regulate gene expression in the pathogenesis of many human malignancies. However, their roles in cervical adenocarcinoma remain largely unknown. In this study, we aimed to seek novel circRNAs that regulate
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej