Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU015991

Sigma-Aldrich

MISSION® esiRNA

targeting human SSRP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCAAACTCGCTACCACTTCCTGATCCTCCTCTTCTCCAAGGACGAGGACATTTCGTTGACTCTGAACATGAACGAGGAAGAAGTGGAGAAGCGCTTTGAGGGTCGGCTCACCAAGAACATGTCAGGATCCCTCTATGAGATGGTCAGCCGGGTCATGAAAGCACTGGTAAACCGCAAGATCACAGTGCCAGGCAACTTCCAAGGGCACTCAGGGGCCCAGTGCATTACCTGTTCCTACAAGGCAAGCTCAGGACTGCTCTACCCGCTGGAGCGGGGCTTCATCTACGTCCACAAGCCACCTGTGCACATCCGCTTCGATGAGATCTCCTTTGTCAACTTTGCTCGTGGTACCACTACTACTCGTTCCTTTGACTTTGAAATTGAGACCAAGCAGGGCACTCAGTATACCTTCAGCAGCATTGAGAGGGAGGAGTACGGGAAACTGTTTGATTTTGTCAACGCGAAAAAGCTCAACATCAAAAACCGAGGATTGAAAGAGGGCATGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000149136

numer dostępu NCBI

NM_003146

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SSRP1(6749) , SSRP1(6749)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Wenyong Long et al.
Journal of molecular cell biology, 10(2), 147-160 (2018-02-17)
The differentiation status of neuroblastoma (NB) strongly correlates with its clinical outcomes; however, the molecular mechanisms driving maintenance of stemness and differentiation remain poorly understood. Here, we show that plant homeodomain finger-containing protein 20 (PHF20) functions as a critical epigenetic
Alan S Wang et al.
Molecular cell, 79(2), 221-233 (2020-07-01)
Cas9 is a prokaryotic RNA-guided DNA endonuclease that binds substrates tightly in vitro but turns over rapidly when used to manipulate genomes in eukaryotic cells. Little is known about the factors responsible for dislodging Cas9 or how they influence genome engineering.
Ying Gao et al.
Cancer research, 77(10), 2674-2685 (2017-04-19)
DNA single-strand breaks (SSB) are the most common form of DNA damage, requiring repair processes that to initiate must overcome chromatin barriers. The FACT complex comprised of the SSRP1 and SPT16 proteins is important for maintaining chromatin integrity, with SSRP1
Miranda M Tallman et al.
Cancer letters, 499, 232-242 (2020-12-01)
Glioblastoma (GBM) is an incurable brain tumor with inevitable recurrence. This is in part due to a highly malignant cancer stem cell (CSC) subpopulation of tumor cells that is particularly resistant to conventional treatments, including radiotherapy. Here we show that
Ling Bi et al.
International journal of cancer, 145(1), 164-178 (2018-12-15)
Cancer cell repopulation through cell cycle re-entry by quiescent (G0 ) cell is thought to be an important mechanism behind treatment failure and cancer recurrence. Facilitates Chromatin Transcription (FACT) is involved in DNA repair, replication and transcription by eviction of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej