Skip to Content
Merck
All Photos(1)

Documents

EHU093841

Sigma-Aldrich

MISSION® esiRNA

targeting human RORC

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGAAGTCCATGTGGGAGATGTGGGAACGGTGTGCCCACCACCTCACCGAGGCCATTCAGTACGTGGTGGAGTTCGCCAAGAGGCTCTCAGGCTTTATGGAGCTCTGCCAGAATGACCAGATTGTGCTTCTCAAAGCAGGAGCAATGGAAGTGGTGCTGGTTAGGATGTGCCGGGCCTACAATGCTGACAACCGCACGGTCTTTTTTGAAGGCAAATACGGTGGCATGGAGCTGTTCCGAGCCTTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTGCACTTTTCCGAGGATGAGATTGCCCTCTACACAGCCCTTGTTCTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTT

Ensembl | human accession no.

ENSG00000143365

NCBI accession no.

NM_001001523

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RORC(6097) , RORC(6097)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Geyang Xu et al.
Molecular and cellular endocrinology, 416, 9-18 (2015-08-19)
Glucagon-like peptide (GLP-1), an intestinal incretin produced in L-cells and released in response to meal intake, functions to promote insulin secretion and to decrease plasma glucose. Ghrelin is an orexigenic hormone critical for glucose homeostasis. The molecular mechanism by which
Yun-Jeong Jeong et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 68, 218-225 (2014-03-29)
Bee venom is a natural compound produced by the honey bee (Apis mellifera), and has been reported as having the biological and pharmacological activities, including anti-bacterial, anti-viral and anti-inflammation. In the present study, the inhibitory effects of bee venom and
Hong Zhang et al.
International journal of molecular sciences, 19(4) (2018-04-05)
20(S)-Protopanaxadiol (PPD) is one of the major active metabolites of ginseng. It has been reported that 20(S)-PPD shows a broad spectrum of antitumor effects. Our research study aims were to investigate whether apoptosis of human breast cancer MCF-7 cells could
Jia-Hui Rong et al.
OncoTargets and therapy, 14, 289-300 (2021-01-21)
In recent years, radioactive 125I seed implantation combined with chemotherapy has been regarded as a safe and effective treatment for advanced non-small cell lung cancer (NSCLC). However, the mechanism underlying this success is still unclear. In this study, we investigated
Nishant S Gandhi et al.
Pharmaceutical research, 35(10), 188-188 (2018-08-15)
Lung cancer is one of the leading causes of deaths in the United States, but currently available therapies for lung cancer are associated with reduced efficacy and adverse side effects. Small interfering RNA (siRNA) can knock down the expression of
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service