Skip to Content
Merck
All Photos(1)

Documents

EHU040501

Sigma-Aldrich

MISSION® esiRNA

targeting human UHRF1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCCGGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACAGGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGCCAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGCAAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGGTTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCTTCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGGATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGGCCAACCGAGAGCGAGAGAAGGAGAA

Ensembl | human accession no.

ENSG00000034063

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... UHRF1(29128) , UHRF1(29128)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mahmoud Alhosin et al.
Technology in cancer research & treatment, 19, 1533033820947489-1533033820947489 (2020-09-12)
Thymoquinone (TQ), a natural anticancer agent exerts cytotoxic effects on several tumors by targeting multiple pathways, including apoptosis. Difluoromethylornithine (DFMO), an irreversible inhibitor of the ornithine decarboxylase (ODC) enzyme, has shown promising inhibitory activities in many cancers including leukemia by
Jieying Chen et al.
Journal of cellular and molecular medicine, 22(5), 2856-2864 (2018-03-09)
WD repeat protein 79 (WDR79) is a member of the WD-repeat protein family characterized by the presence of a series of WD-repeat domains and is a scaffold protein that participates in telomerase assembly, Cajal body formation and DNA double strand
Daiki Goto et al.
Cancer investigation, 38(4), 240-249 (2020-03-28)
We evaluated the value of UHRF1, a regulator of methylation, as a biomarker for lung cancer. UHRF1 is expressed at higher levels in both lung adenocarcinoma (AD) and squamous cell carcinoma (SQ); however, a meta-analysis showed that UHRF1 expression is
Ting-Ting Ge et al.
Journal of ovarian research, 9(1), 42-42 (2016-07-20)
Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells.
Guangyan Kan et al.
Oncotarget, 8(24), 39497-39511 (2017-05-04)
UHRF1 (ubiquitin-like with PHD and RING finger domains 1) is a critical regulator for DNA methylation, and its frequent overexpression in human cancers has been associated with tumor-promoting effects. However, whether the overexpressed UHRF1 contributes to the establishment and maintenance
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service