Skip to Content
Merck
All Photos(1)

Documents

EHU036201

Sigma-Aldrich

MISSION® esiRNA

targeting human CD80

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGCACAAACTCGCATCTACTGGCAAAAGGAGAAGAAAATGGTGCTGACTATGATGTCTGGGGACATGAATATATGGCCCGAGTACAAGAACCGGACCATCTTTGATATCACTAATAACCTCTCCATTGTGATCCTGGCTCTGCGCCCATCTGACGAGGGCACATACGAGTGTGTTGTTCTGAAGTATGAAAAAGACGCTTTCAAGCGGGAACACCTGGCTGAAGTGACGTTATCAGTCAAAGCTGACTTCCCTACACCTAGTATATCTGACTTTGAAATTCCAACTTCTAATATTAGAAGGATAATTTGCTCAACCTCTGGAGGTTTTCCAGAGCCTCACCTCTCCTGGTTGGAAAATGGAGAAGAATTAAATGCCATCAACACAACAGTTTCCCAAGATCCTGAAACTGAGCTCTATGCTGTTAGCAGCAAACTGGATTTCAATATGACAACCAACCACAGCTTCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chenxia Juan et al.
The international journal of biochemistry & cell biology, 104, 138-148 (2018-09-24)
Neonatal respiratory distress syndrome (NRDS) is a leading cause of morbidity in premature newborns and is a common reason for admission to the neonatal intensive care unit (NICU). Recent studies found that the pathogenesis of NRDS is not simply lung
Yuxuan Miao et al.
Cell, 177(5), 1172-1186 (2019-04-30)
Our bodies are equipped with powerful immune surveillance to clear cancerous cells as they emerge. How tumor-initiating stem cells (tSCs) that form and propagate cancers equip themselves to overcome this barrier remains poorly understood. To tackle this problem, we designed
Xusheng Zhang et al.
Journal of translational medicine, 12, 142-142 (2014-06-03)
While substantial progress has been made in blocking acute transplant rejection with the advent of immune suppressive drugs, chronic rejection, mediated primarily by recipient antigen presentation, remains a formidable problem in clinical transplantation. We hypothesized that blocking co-stimulatory pathways in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service