Skip to Content
Merck
All Photos(1)

Key Documents

EHU005501

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K21

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
PLN 1,060.00
50 μG
PLN 1,910.00

PLN 1,060.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
PLN 1,060.00
50 μG
PLN 1,910.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

PLN 1,060.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTCCATCGTTTGCCTTAATTCTCGAACAGTTGACTGCTATTGAAGGGGCAGTGATGACTGAGATGCCTCAAGAATCTTTTCATTCCATGCAAGATGACTGGAAACTAGAAATTCAACAAATGTTTGATGAGTTGAGAACAAAGGAAAAGGAGCTGCGATCCCGGGAAGAGGAGCTGACTCGGGCGGCTCTGCAGCAGAAGTCTCAGGAGGAGCTGCTAAAGCGGCGTGAGCAGCAGCTGGCAGAGCGCGAGATCGACGTGCTGGAGCGGGAACTTAACATTCTGATATTCCAGCTAAACCAGGAGAAGCCCAAGGTAAAGAAGAGGAAGGGCAAGTTTAAGAGAAGTCGTTTAAAGCTCAAAGATGGACATCGAATCAGTTTACCTTCAGATTTCCAGCACAAGATAACCGTGCAGGCCTCTCCCAACTTGGACAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stefen A Boehme et al.
PloS one, 11(5), e0154874-e0154874 (2016-05-06)
Idiopathic pulmonary fibrosis (IPF) is a progressive, debilitating disease for which two medications, pirfenidone and nintedanib, have only recently been approved for treatment. The cytokine TGF-β has been shown to be a central mediator in the disease process. We investigated
Stefen A Boehme et al.
PloS one, 11(12), e0167169-e0167169 (2016-12-10)
Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung inflammation resulting in a progressive decline in lung function whose principle cause is cigarette smoke. MAP3K19 is a novel kinase expressed predominantly by alveolar and interstitial macrophages

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service