All Photos(1)

Key Documents

COO/COA

View All Documentation

EHU020001

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human IRF3

Sign Into View Organizational & Contract Pricing

All Photos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

description

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTGACAGCCTTCTACCG

Ensembl | human accession no.

ENSG00000126456

NCBI accession no.

NM_001571

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRF3(3661) , IRF3(3661)

Related Categories

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Transfection of poly(I:C) can induce reactive oxygen species-triggered apoptosis and interferon-β-mediated growth arrest in human renal cell carcinoma cells via innate adjuvant receptors and the 2-5A system.

Nanae Harashima et al.

Molecular cancer, 13, 217-217 (2014-09-18)

Synthetic double-stranded RNA poly(I:C) is a useful immune adjuvant and exhibits direct antitumor effects against several types of cancers. In this study, we elucidated the mechanisms underlying the effects induced in poly(I:C)-transfected human renal cell carcinoma (RCC) cells. In contrast

Mechanisms and roles by which IRF-3 mediates the regulation of ORMDL3 transcription in respiratory syncytial virus infection.

Xiao-Hua Wang et al.

The international journal of biochemistry & cell biology, 87, 8-17 (2017-03-25)

Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis in infancy, which is a major risk factor for recurrent wheezing and asthma. Orosomucoid 1-like protein 3 (ORMDL3) has been reported to associate with virus-triggered recurrent wheezing and asthma in

Respiratory virus-induced EGFR activation suppresses IRF1-dependent interferon λ and antiviral defense in airway epithelium.

Iris F Ueki et al.

The Journal of experimental medicine, 210(10), 1929-1936 (2013-09-04)

Viruses suppress host responses to increase infection, and understanding these mechanisms has provided insights into cellular signaling and led to novel therapies. Many viruses (e.g., Influenza virus, Rhinovirus [RV], Cytomegalovirus, Epstein-Barr virus, and Hepatitis C virus) activate epithelial epidermal growth

Type I Interferon Induced Epigenetic Regulation of Macrophages Suppresses Innate and Adaptive Immunity in Acute Respiratory Viral Infection.

Danielle N Kroetz et al.

PLoS pathogens, 11(12), e1005338-e1005338 (2015-12-29)

Influenza A virus (IAV) is an airborne pathogen that causes significant morbidity and mortality each year. Macrophages (Mϕ) are the first immune population to encounter IAV virions in the lungs and are required to control infection. In the present study

The Cooperative Induction of CCL4 in Human Monocytic Cells by TNF-α and Palmitate Requires MyD88 and Involves MAPK/NF-κB Signaling Pathways.

Sardar Sindhu et al.

International journal of molecular sciences, 20(18) (2019-09-25)

Chronic low-grade inflammation, also known as metabolic inflammation, is a hallmark of obesity and parallels with the presence of elevated circulatory levels of free fatty acids and inflammatory cytokines/chemokines. CCL4/MIP-1β chemokine plays a key role in the adipose tissue monocyte

View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service