Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU066621

Sigma-Aldrich

MISSION® esiRNA

targeting human ARID1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

Ensembl | human accession no.

ENSG00000117713

NCBI accession no.

NM_006015

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ARID1A(8289) , ARID1A(8289)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Chun Tseng et al.
Molecular reproduction and development, 84(12), 1250-1256 (2017-11-28)
Mammalian embryos undergo dramatic epigenetic remodeling that can have a profound impact on both gene transcription and overall embryo developmental competence. Members of the SWI/SNF (Switch/Sucrose non-fermentable) family of chromatin-remodeling complexes reposition nucleosomes and alter transcription factor accessibility. These large
Dakeun Lee et al.
OncoTargets and therapy, 10, 4153-4159 (2017-09-02)
The At-rich interactive domain 1A (ARID1A) is frequently mutated in gastric cancers (GCs) with a poor prognosis. Growing evidence indicates that loss of ARID1A expression leads to activation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway by AKT phosphorylation. We aim to
Wen Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2420-2433 (2017-10-27)
We previously performed microRNA (miRNA) microarray to identify effective indicators of clear cell renal cell carcinoma (ccRCC) tissue samples and preoperative/postoperative plasma in which we identified miR-144-3p as an oncomiRNA. However, the molecular mechanism of miR-144-3p remains unclear. This study
Yan Yang et al.
Anti-cancer drugs, 31(4), 368-376 (2020-01-09)
Gastric cancer (GC) is lethal and there is an urgent need for improved understanding of this disease. Recent studies have reported that microRNAs (miRNAs) play increasingly important roles in the regulation of GC. In this study, we explored the target
Saravana P Selvanathan et al.
Nucleic acids research, 47(18), 9619-9636 (2019-08-09)
Connections between epigenetic reprogramming and transcription or splicing create novel mechanistic networks that can be targeted with tailored therapies. Multiple subunits of the chromatin remodeling BAF complex, including ARID1A, play a role in oncogenesis, either as tumor suppressors or oncogenes.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico