Skip to Content
Merck
All Photos(1)

Key Documents

EHU076761

Sigma-Aldrich

MISSION® esiRNA

targeting human EGFR

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCAC

Ensembl | human accession no.

ENSG00000146648

NCBI accession no.

NM_005228

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EGFR(1956) , EGFR(1956)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Deepak Bhere et al.
Scientific reports, 10(1), 1779-1779 (2020-02-06)
Dysregulation of miRNA expression has been implicated in cancer. Numerous strategies have been explored to modulate miR but sub-optimal delivery and inability to concurrently target multiple pathways involved in tumor progression have limited their efficacy. In this study, we explored
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Meifang Li et al.
Journal of experimental & clinical cancer research : CR, 38(1), 211-211 (2019-05-24)
Epidermal growth factor receptor (EGFR) and epidermal growth factor receptor pathway substrate 8 (Eps8) have been widely reported to be expressed in various tumors. Eps8 is an important active kinase substrate of EGFR that directly binds to the juxtamembrane (JXM)
Yu-Wei Lin et al.
Scientific reports, 7(1), 9814-9814 (2017-08-31)
The poor intracellular uptake and non-specific binding of anticancer drugs into cancer cells are the bottlenecks in cancer therapy. Nanocarrier platforms provide the opportunities to improve the drug efficacy. Here we show a carbon-based nanomaterial nanodiamond (ND) that carried paclitaxel
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service