Skip to Content
Merck
All Photos(1)

Key Documents

EMU090561

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nod2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGCCATTCTGGAGGTTTGGCTTCGAGGGAACACATTCTCTTTGGAGGAAATCCAAACACTGAGCTCCAGGGACGCCAGACTCTTGTTGTGATGTCTCCGTTTGTGAGTGGACTGTAGGGGCCTGGACTCTGGAGGCTGAGTAACATCAGGCAGAATCCCTCTGCTACGCAGGGCTGGTTTGCTTTTCTGGATGCAGTATAGTCACCTTCTGTTAGCAGAGAAAGTCACCCCATTGCCGTCTGGAATTGACTTTTCCCGAGGAGTCGTGATGGTTGGTCTTGGTTGTTAACTGCACTGACTTAAGAGAGTCATGAGCCGAGAGGACCGCGTTTCTGCCTCTAAAGAGGATCACCATGCAGAATTAGTGACTGGAAGGGGAAAGGCCCTCACTGCATGTGGGTGACACAATCCTCTCTGGTTGCCCCGTGGGAGGATGATGGAGGAGGAGGAAGACAGGGTATGCTTGCATATGTGAGCATTTCTTCTGAGTGAGGACAGCTGTGGTTGCTGCCCTCATGTTTGAACAGCAGACTCCAGCGTCTTTGGCCATTCAACATGGACCCATCACCAGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Ke et al.
The Journal of endocrinology, 235(2), 85-96 (2017-08-06)
Nucleotide-binding oligomerization domain-2 (NOD2) is a pattern recognition receptor of the innate immune system. It interacts with serine-threonine kinases to induce activation of nuclear factor κB (NF-κB), which is important for receptor activator of nuclear factor kappa-B ligand (RANKL) signaling.
Michelle B Landes et al.
Journal of leukocyte biology, 97(6), 1111-1119 (2015-03-25)
M.tb, which causes TB, is a host-adapted intracellular pathogen of macrophages. Macrophage intracellular PRRs, such as NOD proteins, regulate proinflammatory cytokine production in response to various pathogenic organisms. We demonstrated previously that NOD2 plays an important role in controlling the
Sang-Im Lee et al.
Clinical oral investigations, 19(6), 1419-1428 (2014-12-04)
The expression levels of intracellular pyrin domain-containing 3 (NLRP3) and microbial pattern-recognition receptors, such as nucleotide-binding oligomerization domain 2 (NOD2), have been reported in human dental pulp cells (HDPCs) and inflamed dental pulp tissue, but the role of NLRP3 and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service