Skip to Content
Merck
All Photos(1)

Key Documents

EHU024631

Sigma-Aldrich

MISSION® esiRNA

targeting human SMPD3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACGTGGCCTATCACTGTTACCCCAACAAGTGTAACGACGATGCCCTGGCCTCTAAGGGAGCTCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTCGGGTACATCGCCTGCACACACCTGCATGCCCCGCAAGAGGACAGCGCCATCCGGTGTGGGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCGTCCAGCGCAGCCAACCCCGAGGAGCTGGTGGCATTTGACGTCGTCTGTGGAGATTTCAACTTTGATAACTGCTCCTCTGACGACAAGCTGGAGCAGCAACACTCCCTGTTCACCCACTACAGGGACCCCTGCCGCCTGGGGCCTGGTGAGGAGAAGCCGTGGGCCATCGGTACTCTGCTGGACACGAACG

Ensembl | human accession no.

ENSG00000103056

NCBI accession no.

NM_018667

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SMPD3(55512) , SMPD3(55512)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

James Lawson et al.
Oncotarget, 8(48), 83913-83924 (2017-11-16)
Extracellular vesicles (EVs) are key signaling mediators between cancer cells and their supporting stroma, and regulate critical processes such as invasion, metastases, and angiogenesis. We have identified a subset of miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, miR-605-5p) that
Kyle I Mentkowski et al.
American journal of physiology. Heart and circulatory physiology, 318(6), H1447-H1460 (2020-04-25)
Macrophages play a pivotal role in tissue repair following myocardial infarction (MI). In response to injury, they exist along a spectrum of activation states tightly regulated by their microenvironment. Cardiosphere-derived cells (CDCs) have been shown to mediate cardioprotection via modulation
Ji Na Kong et al.
International journal of cancer, 137(7), 1610-1620 (2015-04-03)
Many breast cancer cells acquire multidrug resistance (MDR) mediated by ABC transporters such as breast cancer resistance protein (BCRP/ABCG2). Here we show that incubation of human breast cancer MDA-MB-231 cells with farnesoid X receptor antagonist guggulsterone (gug) and retinoid X
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service