Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU014081

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM14

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCAGAGTCGCAGCTTTCGTTCCGCCGCTCGCCGACAAAGTCCTCGCTGGATTACCGTCGCCTGCCCGATGCCCATTCCGATTACGCACGCTATTCGGGCTCCTATAATGATTACCTGCGGGCGGCTCAGATGCACTCTGGCTACCAGCGCCGCATGTAGGGCCATCCTGGGATGGGGCACCACAGGGAGGGAGGGAGAAAAGAGGTGGGTAGGGTTACAGATCCAGGTTATAACTACTCTGGCCCATACCTTTCCTGGTTGTGGTTTTTCATGCCCTCTACCATGTGGGCCTTCCCCAGGAGATGATCCTGTTAAGTGTTCGGCAGTAACCTACTTTGTTCCTTCGCCTCAGCAGCAAATCTTGCTACTGGCTCTAGATCTGCGGTTTCCCCTCTACCCTGCCTCCCGTCTCCCCAGAATGGGAATT

Ensembl | human accession no.

ENSG00000173959

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RBM14(10432) , RBM14(10432)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Song Gao et al.
International journal of oncology, 54(6), 1921-1932 (2019-05-14)
Osteosarcoma (OS) is a common primary malignancy in adolescents and children. MicroRNAs (miRNAs or miRs) can regulate the progression of OS. Herein, we explored the target genes and effects of miR‑9 in OS. Cell growth, colony formation and cell cycle
Tapasi Rana et al.
American journal of respiratory cell and molecular biology, 62(3), 319-330 (2019-09-13)
Senescence of alveolar type II (ATII) cells, progenitors of the alveolar epithelium, is a pathological feature and contributes importantly to the pathogenesis of idiopathic pulmonary fibrosis. Despite recognition of the importance of ATII cell senescence in idiopathic pulmonary fibrosis pathogenesis
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service