Skip to Content
Merck
All Photos(1)

Documents

EHU153581

Sigma-Aldrich

MISSION® esiRNA

targeting human TESC

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTACCATTCGCAAGGAGAACTTCAACAATGTCCCGGACCTGGAGCTCAACCCCATCCGATCCAAAATTGTTCGTGCCTTCTTCGACAACAGGAACCTGCGCAAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATGTCCTACTTCCGGCCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTGAGATTTCTGTTCCACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTAAAGTGGTCGAGGAGCTGCTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ai-Jing Luo et al.
Experimental and molecular pathology, 107, 110-117 (2018-12-31)
Renal cell carcinoma (RCC) is the most common form of kidney cancer. Recent studies reported that Tescalcin was overexpressed in various tumor types. However, the status of Tescalcin protein expression in RCC and its biological function is uncertain. This study
Jieun Kang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13843-13853 (2016-08-04)
We reported previously that tescalcin (TESC) levels were higher in tissue and serum from colorectal cancer (CRC) patients and suggested that TESC was a potential oncotarget in CRC. The aim of this study was to investigate the function of TESC
Yun Hee Kang et al.
Oncotarget, 5(8), 2149-2160 (2014-05-09)
Tescalcin (TESC) is an EF-hand calcium binding protein that is differentially expressed in several tissues, however it is not reported that the expression and functional roles of TESC in colorectal cancer. Levels of messenger RNA (mRNA) and protein expression of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service