Skip to Content
Merck
All Photos(1)

Documents

EHU068001

Sigma-Aldrich

MISSION® esiRNA

targeting human NR3C1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAAGTGTTATATGCAGGATATGATAGCTCTGTTCCAGACTCAACTTGGAGGATCATGACTACGCTCAACATGTTAGGAGGGCGGCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAGTTCCTAAGGACGGTCTGAAGAGCC

Ensembl | human accession no.

ENSG00000113580

NCBI accession no.

NM_000176

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NR3C1(2908) , NR3C1(2908)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Samaresh Sau et al.
Molecular and cellular biochemistry, 436(1-2), 119-136 (2017-06-07)
Glucocorticoid, such as dexamethasone (Dex) is often used along with chemotherapy to antagonize side effects of chemotherapy. However, sustained use of Dex frequently develops drug resistance in patients. As a strategy to re-induce drug sensitivity, we planned to modify Dex
Tetsuya Homma et al.
Medicina (Kaunas, Lithuania), 56(3) (2020-03-04)
Viral infection is the main cause of asthma and COPD (chronic obstructive pulmonary disease) exacerbation and accumulate inflammatory cells to airway tissue. We have reported poly I:C, a mimic product of the virus and ligand of toll-like receptor 3 (TLR3)
Benjamin Small et al.
The Journal of clinical endocrinology and metabolism, 105(3) (2019-10-31)
The selective progesterone modulator ulipristal acetate (ulipristal) offers a much-needed therapeutic option for the clinical management of uterine fibroids. Although ulipristal initially passed safety evaluations in Europe, postmarketing analysis identified cases of hepatic injury and failure, leading to restrictions on
Weiping Qin et al.
Biochemical and biophysical research communications, 450(2), 979-983 (2014-06-28)
Glucocorticoids stimulate muscle atrophy through a cascade of signals that includes activation of FoxO transcription factors which then upregulate multiple genes to promote degradation of myofibrillar and other muscle proteins and inhibit protein synthesis. Our previous finding that glucocorticoids upregulate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service