Skip to Content
Merck
All Photos(1)

Key Documents

EHU039121

Sigma-Aldrich

MISSION® esiRNA

targeting human CD5

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Estimated to ship on11 April 2025



Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Estimated to ship on11 April 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTTGTCACATGCCAGGATCCAAACCCCGCAGGCCTGGCCGCAGGCACGGTGGCAAGCATCATCCTGGCCCTGGTGCTCCTGGTGGTGCTGCTGGTCGTGTGCGGCCCCCTTGCCTACAAGAAGCTAGTGAAGAAATTCCGCCAGAAGAAGCAGCGCCAGTGGATTGGCCCAACGGGAATGAACCAAAACATGTCTTTCCATCGCAACCACACGGCAACCGTCCGATCCCATGCTGAGAACCCCACAGCCTCCCACGTGGATAACGAATACAGCCAACCTCCCAGGAACTCCCACCTGTCAGCTTATCCAGCTCTGGAAGGGGCTCTGCATCGCTCCTCCATGCAGCCTGACAACTCCTCCGACAGTGACTATGATCTGCATGGGGCTCAGAGGCTGTAAAGAACTGGGATCCATGAGCAAAAAGCCGAGAGCCAGACCTGTTTGTCCTGAGAAAACTGTCCGCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD5(921) , CD5(921)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Uri Rozovski et al.
Molecular cancer research : MCR, 15(5), 610-618 (2017-01-29)
In chronic lymphocytic leukemia (CLL), STAT3 is constitutively phosphorylated on serine 727 and plays a role in the pathobiology of CLL. However, what induces constitutive phosphorylation of STAT3 is currently unknown. Mass spectrometry was used to identify casein kinase 2
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service