Skip to Content
Merck
All Photos(1)

Key Documents

EHU024791

Sigma-Aldrich

MISSION® esiRNA

targeting human TET2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAGCAGCCAATAGGACATGATCCAGGAAGAGCAGTAAGGGACTGAGCTGCTGAATTCAACTAGAGGGCAGCCTTGTGGATGGCCCCGAAGCAAGCCTGATGGAACAGGATAGAACCAACCATGTTGAGGGCAACAGACTAAGTCCATTCCTGATACCATCACCTCCCATTTGCCAGACAGAACCTCTGGCTACAAAGCTCCAGAATGGAAGCCCACTGCCTGAGAGAGCTCATCCAGAAGTAAATGGAGACACCAAGTGGCACTCTTTCAAAAGTTATTATGGAATACCCTGTATGAAGGGAAGCCAGAATAGTCGTGTGAGTCCTGACTTTACACAAGAAAGTAGAGGGTATTCCAAGTGTTTGCAAAATGGAGGAATAAAACGCACAGTTAGTGAACCTTCTCTCTCTGGGCTCC

Ensembl | human accession no.

ENSG00000168769

NCBI accession no.

NM_017628

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TET2(54790) , TET2(54790)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Elena F M Manzoni et al.
Scientific reports, 6, 37017-37017 (2016-11-15)
Phenotype definition is controlled by epigenetic regulations that allow cells to acquire their differentiated state. The process is reversible and attractive for therapeutic intervention and for the reactivation of hypermethylated pluripotency genes that facilitate transition to a higher plasticity state.
Juan Peng et al.
Frontiers in pharmacology, 8, 486-486 (2017-08-12)
Ten-eleven translocation-2 (TET2) protein is a DNA demethylase that regulates gene expression through DNA demethylation and also plays important roles in various diseases including atherosclerosis. Endothelial dysfunction represents an early key event in atherosclerotic disease. The cystathionine-γ-lyase (CSE)/hydrogen sulfide (H
Xixia Zhang et al.
Cancer cell international, 20, 363-363 (2020-08-11)
Nasopharyngeal carcinoma (NPC) is a common malignant tumor. Ten-eleven translocation (TET) protein 2 (TET2), an evolutionarily conserved dioxygenases, is reported to be involved in various malignant tumor developments. Here, we aim to investigate the effect of TET2 on NPC progress
Juan Peng et al.
Oncotarget, 7(47), 76423-76436 (2016-11-09)
Tet methylcytosine dioxygenase 2 (TET2) mediates the conversion of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC). The loss of TET2 is associated with advanced atherosclerotic lesions. Our previous study showed that TET2 improves endothelial cell function by enhancing endothelial cell autophagy. Accordingly
Zhaocai He et al.
American journal of translational research, 10(10), 3211-3223 (2018-11-13)
To explore the effect of fetal-lethal non-coding developmental regulatory RNA (FENDRR) in the initiation and progression of gastric cancer (GC). We detected the levels of FENDRR, microRNA-214-3p (miR-214-3p), and ten-eleven-translocation (TET2) in GC tissues and GC cell lines. In addition
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service