Skip to Content
Merck
All Photos(1)

Key Documents

EHU002271

Sigma-Aldrich

MISSION® esiRNA

targeting human LEF1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Estimated to ship on14 April 2025



Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Estimated to ship on14 April 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

P Wu et al.
Cell death & disease, 5, e1085-e1085 (2014-03-01)
Inhibitor-of-apoptosis protein (IAP) inhibitors have been reported to synergistically reduce cell viability in combination with a variety of chemotherapeutic drugs via targeted cellular IAP (cIAP) depletion. Here, we found that cIAP silencing sensitised colorectal cancer (CRC) cells to selenite-induced apoptosis.
Yaoyao Chen et al.
Stem cell reports, 1(3), 209-217 (2013-12-10)
Germline-competent embryonic stem cells (ESCs) have been derived from mice and rats using culture conditions that include an inhibitor of glycogen synthase kinase 3 (GSK3). However, rat ESCs remain susceptible to sporadic differentiation. Here, we show that unsolicited differentiation is
Julia Dräger et al.
Oncotarget, 8(2), 3259-3273 (2016-12-15)
Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and show characteristics of skeletal muscle differentiation. The two major RMS subtypes in children are alveolar (ARMS) and embryonal RMS (ERMS). We demonstrate that approximately 50% of ARMS and
Rhys G Morgan et al.
Haematologica, 104(7), 1365-1377 (2019-01-12)
Canonical Wnt/β-catenin signaling is frequently dysregulated in myeloid leukemias and is implicated in leukemogenesis. Nuclear-localized β-catenin is indicative of active Wnt signaling and is frequently observed in acute myeloid leukemia (AML) patients; however, some patients exhibit little or no nuclear
Fangfang Zhou et al.
Molecular biology of the cell, 22(18), 3533-3540 (2011-07-29)
Glycogen synthase kinase 3β (GSK3β) regulates diverse physiological processes, including metabolism, development, oncogenesis, and neuroprotection. GSK3β kinase activity has been reported to be critical for various types of cancer cells, but the mechanism has remained elusive. In this study we

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service