Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU014751

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Eif2ak3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGATCAAATGGAAGCCCTTAATCCATTCTCCTTCTAGGACTCCTGTCTTGGTTGGGTCTGATGAATTTGACAAATGTCTAAGTAATGATAAGTATTCCCACGAAGAATACAGTAATGGTGCACTTTCAATCCTCCAGTATCCATACGATAACGGTTACTATCTGCCATACTACAAGAGAGAAAGGAATAAGCGGAGCACGCAGATCACAGTCAGGTTCCTGGACAGCCCCCACTACAGCAAGAACATCCGCAAGAAGGACCCTATCCTCCTGCTGCACTGGTGGAAGGAGATATTCGGGACGATCCTGCTTTGCATCGTAGCCACGACCTTCATCGTGCGCAGGCTTTTCCATCCTCAGCCCCACAGGCAGCGGAAGGAGTCTGAAACTCAGTGCCAGACTGAAAGTAAATACGACTCCGTGAGTGCC

Ensembl | mouse accession no.

ENSMUSG00000031668

NCBI accession no.

NM_010121

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EIF2AK3(13666) , Eif2ak3(13666)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yue Wang et al.
Antiviral research, 106, 33-41 (2014-04-01)
The unfolded protein response (UPR) is cyto-protective machinery elicited towards an influx of large amount of protein synthesis in the endoplasmic reticulum (ER). Extensive studies suggest that the UPR can also be activated during virus infection. In the present studies
Genkai Guo et al.
Journal of immunology research, 2015, 183738-183738 (2015-06-20)
Previous studies indicated that bone marrow mesenchymal stem cells (BM-MSCs) from patients with systemic lupus erythematosus (SLE) exhibited the phenomenon of apoptosis. In this study, we aimed to investigate whether apoptosis of BM-MSCs from SLE patients were dysregulated. In this
Fei Sun et al.
Toxicology, 325, 52-66 (2014-08-19)
While it has been well-documented that excessive fluoride exposure caused the skeletal disease and osteoblasts played a critical role in the advanced skeletal fluorosis, the underlying mechanism that mediated these effects remain poorly understood. The present study was undertaken to
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico