Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU161041

Sigma-Aldrich

MISSION® esiRNA

targeting human GPBAR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCGGGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACTGGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATGGGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGGGAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCTGGACTTGAACTAAAGGAAGGGCCTCTGCTGACTCCTACCAGAGCATCCGTCCAGCTCAGCCATCCAGCCTGTCTCTACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hui Liang et al.
Journal of neuroinflammation, 18(1), 40-40 (2021-02-04)
Nucleotide-binding oligomerization domain-like receptor pyrin domain-containing protein 3 (NLRP3) plays an important role in mediating inflammatory responses during ischemic stroke. Bile acid receptor Takeda-G-protein-receptor-5 (TGR5) has been identified as an important component in regulating brain inflammatory responses. In this study
Ai-Di Li et al.
Experimental cell research, 389(2), 111855-111855 (2020-01-25)
Takeda-G-protein-receptor-5 (TGR5) is a G-protein-coupled receptor (GPCR) activated by bile acids, and mortalin is a multipotent chaperone of the HSP70 family. In the present study, TGR5 was detected by immunohistochemistry (IHC) in extrahepatic cholangiocarcinoma (ECC) specimens, and TGR5 expression in
Yu Chen et al.
International immunopharmacology, 71, 144-154 (2019-03-23)
NLRP3 inflammasome has been reported to be associated with inflammatory bowel disease including colitis due to its potential ability to induce IL-1β secretion. Emerging studies have demonstrated that Genistein, a major isoflavone, has potential anti-inflammatory effects in murine model colitis.
You-Chao Qi et al.
Chinese journal of natural medicines, 18(12), 898-906 (2020-12-29)
Taurochenodeoxycholic acid (TCDCA) is one of the main effective components of bile acid, playing critical roles in apoptosis and immune responses through the TGR5 receptor. In this study, we reveal the interaction between TCDCA and TGR5 receptor in TGR5-knockdown H1299
Haiming Xiao et al.
Pharmacological research, 151, 104559-104559 (2019-11-24)
Our previous studies indicated that the G-protein-coupled bile acid receptor, Gpbar1 (TGR5), inhibits inflammation by inhibiting the NF-κB signalling pathway, eventually attenuating diabetic nephropathy (DN). Gentiopicroside (GPS), the main active secoiridoid glycoside of Gentiana manshurica Kitagawa, has been demonstrated to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico