Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU149811

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGTGGGCTTTTTCCCTTTTTTGCTCCTTTTCATTACCCCTCCTCCGTTTTCACCCTTCTCCGGACTTCGCGTAGAACCTGCGAATTTCGAAGAGGAGGTGGCAAAGTGGGAGAAAAGAGGTGTTAGGGTTTGGGGTTTTTTTGTTTTTGTTTTTGTTTTTTAATTTCTTGATTTCAACATTTTCTCCCACCCTCTCGGCTGCAGCCAACGCCTCTTACCTGTTCTGCGGCGCCGCGCACCGCTGGCAGCTGAGGGTTAGAAAGCGGGGTGTATTTTAGATTTTAAGCAAAAATTTTAAAGATAAATCCATTTTTCTCTCCCACCCCCAACGCCATCTCCACTGCATCCGATCTCATTATTTCGGTGGTTGCTTGGGGGTGAACAATTTTGTGGCTTTTTTTCCCCTATAATTCTGACCCGCTCAGGCTTGAGGGTTTCTCCGGCCTCCGCTCACTGCGTGCACCTGGCGCTGCCCTGCTTCCCCCAACCTGTTGCAAGGCTTTAATTCTTGCAACTGGGACCTG

Ensembl | human accession no.

ENSG00000115461

NCBI accession no.

NM_000599

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGFBP5(3488) , IGFBP5(3488)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Younghay Lee et al.
Cells, 8(4) (2019-04-26)
Type 2 diabetes mellitus (T2DM) is a prevalent chronic metabolic disorder accompanied by high blood glucose, insulin resistance, and relative insulin deficiency. Endoplasmic reticulum (ER) stress induced by high glucose and free fatty acids has been suggested as one of
Dong Hyup Lee et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 17(2), 157-162 (2013-04-30)
Insulin-like growth factor binding proteins (IGFBPs) are important components of insulin growth factor (IGF) signaling pathways. One of the binding proteins, IGFBP-5, enhances the actions of IGF-1, which include the enhanced proliferation of smooth muscle cells. In the present study
Bong-Ki Hong et al.
Experimental & molecular medicine, 49(8), e363-e363 (2017-08-05)
Fibroblast-like synoviocytes (FLSs) constitute a major cell subset of rheumatoid arthritis (RA) synovia. Dysregulation of microRNAs (miRNAs) has been implicated in activation and proliferation of RA-FLSs. However, the functional association of various miRNAs with their targets that are characteristic of
Junyun Wang et al.
Oncotarget, 6(24), 20636-20649 (2015-05-27)
The insulin-like growth factor binding protein 5 (IGFBP5), which is often dysregulated in human cancers, plays a crucial role in carcinogenesis and cancer development. However, the function and underlying mechanism of IGFBP5 in tumor growth and metastasis has been elusive
Wenyu Wang et al.
Molecular cancer therapeutics, 17(9), 1973-1983 (2018-06-22)
Despite showing promise against PIK3CA-mutant breast cancers in preclinical studies, PI3K/AKT pathway inhibitors demonstrate limited clinical efficacy as monotherapy. Here, we found that histone H3K27me3 demethylase KDM6B-targeted IGFBP5 expression provides a protective mechanism for PI3K/AKT inhibitor-induced apoptosis in breast cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico