Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU116361

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCCCAGAGCATCATTGACGCAAATGATACTTTGAAGGACTTGACGAAAGTAACATTGGGAGACAATGTGAAATACTACAATTTGGCCAGGATAAAGTGGGACCCCTCTGATCCTCAAATAATATCTGAAGGTCTTTATGCAATTGCTGTAGTTTTAAGTTTCTCTAGGATAGCTTATATTTTACCAGCAAATGAAAGCTTTGGACCTCTGCAGATATCACTTGGAAGAACAGTCAAAGACATCTTCAAGTTCATGGTCATATTCATTATGGTGTTTGTGGCCTTTATGATTGGAATGTTCAATCTCTACTCCTACTACATTGGTGCAAAACAAAATGAAGCCTTCACAACAGTTGAAGAGAGTTTTAAGACACTGTTCTGGGCTATATTTGGACTTTCTGAAGTGAAATCAGTGGTCATCA

Ensembl | human accession no.

ENSG00000137672

NCBI accession no.

NM_004621

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRPC6(7225) , TRPC6(7225)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Haiyang Tang et al.
American journal of physiology. Lung cellular and molecular physiology, 310(9), L846-L859 (2016-03-13)
An increase in cytosolic free Ca(2+) concentration ([Ca(2+)]cyt) in pulmonary arterial smooth muscle cells (PASMC) is a major trigger for pulmonary vasoconstriction and a critical stimulation for PASMC proliferation and migration. Previously, we demonstrated that expression and function of calcium
Liang Wen et al.
Scientific reports, 6, 23269-23269 (2016-03-25)
Hepatocellular carcinoma (HCC) is notoriously refractory to chemotherapy because of its tendency to develop multi-drug resistance (MDR), whose various underlying mechanisms make it difficult to target. The calcium signalling pathway is associated with many cellular biological activities, and is also
Navin K Kapur et al.
Journal of the American Heart Association, 3(4) (2014-07-13)
Right ventricular (RV) failure is a major cause of mortality worldwide and is often a consequence of RV pressure overload (RVPO). Endoglin is a coreceptor for the profibrogenic cytokine, transforming growth factor beta 1 (TGF-β1). TGF-β1 signaling by the canonical
Yan Yang et al.
Cell biochemistry and function, 38(4), 384-391 (2019-12-31)
Acute kidney injury (AKI) is a common adverse reaction of the anticancer drug. Among these chemotherapeutic agents, cisplatin, an effective chemotherapeutic drug, is extensively applied to the treatment of solid tumours, yet various adverse reactions, especially AKI, often limit their
Kazuo Murakami et al.
Fundamental & clinical pharmacology, 31(4), 383-391 (2017-01-21)
We reported that coronary spasm was induced in the transgenic mice with the increased phospholipase C (PLC)-δ1 activity. We investigated the effect of enhanced PLC-δ1 on Ca
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico