Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU112661

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCT

Ensembl | human accession no.

ENSG00000176171

NCBI accession no.

NM_004052

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BNIP3(664) , BNIP3(664)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xianjie Li et al.
International journal of molecular medicine, 46(2), 729-739 (2020-07-07)
Long non‑coding RNA (lncRNA) DGCR5 has been identified as a tumor suppressor in several types of cancer. However, its biological functions in pancreatic cancer (PaCa) have not yet been fully elucidated. The present study was designed to investigate the role
Zong-Jie Fu et al.
Redox biology, 36, 101671-101671 (2020-08-24)
In the present study, we hypothesized that hypoxia-inducible factor 1α (HIF-1α)-mediated mitophagy plays a protective role in ischemia/reperfusion (I/R)-induced acute kidney injury (AKI). Mitophagy was evaluated by measuring the changes of mitophagy flux, mitochondria DNA copy number, and the changes
Zhiliang He et al.
Acta biochimica et biophysica Sinica, 49(1), 25-32 (2016-11-20)
Nutrition deficiency is reported to induce apoptosis of chondrocytes and degeneration of cartilage endplate (CEP) in rabbit. Cartilage endplate stem cells (CESCs) are important for the integrity of structure and function of CEP. Bcl-2/adenovirus E1B 19-kDa-interacting protein 3 (BNIP3) has
Jie Liu et al.
Molecular medicine reports, 16(5), 7253-7260 (2017-09-26)
Nutrient deprivation (ND)‑induced nucleus pulposus (NP) cell death serves an important role in intervertebral disc degeneration disease. However, the underlying mechanisms have yet to be thoroughly elucidated. The present study created a cell culture model under ND conditions to investigate
Jia-Li Chen et al.
Neuropharmacology, 181, 108326-108326 (2020-09-24)
We have previously shown that sphingosine kinase 2 (SPK2) interacts with Bcl-2 via its BH3 domain, activating autophagy by inducing the dissociation of Beclin-1/Bcl-2 complexes, and that a TAT-SPK2 peptide containing the BH3 domain of SPK2 protects neurons against ischemic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico