Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU108861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF2BP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATTAAGATTGCTCCAGCGGAAGCACCAGATGCTAAAGTGAGGATGGTGATTATCACTGGACCACCAGAGGCTCAGTTCAAGGCTCAGGGAAGAATTTATGGAAAAATTAAAGAAGAAAACTTTGTTAGTCCTAAAGAAGAGGTGAAACTTGAAGCTCATATCAGAGTGCCATCCTTTGCTGCTGGCAGAGTTATTGGAAAAGGAGGCAAAACGGTGAATGAACTTCAGAATTTGTCAAGTGCAGAAGTTGTTGTCCCTCGTGACCAGACACCTGATGAGAATGACCAAGTGGTTGTCAAAATAACTGGTCACTTCTATGCTTGCCAGGTTGCCCAGAGAAAAATTCAGGAAATTCTGACTCAGGTAAAGCAGCACCAACAACAGAAGGCTCTGCAAAGTGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huidi Liu et al.
Frontiers in oncology, 9, 1570-1570 (2020-02-23)
Ovarian Clear Cell Carcinoma (OCCC) displays distinctive clinical and molecular characteristics and confers the worst prognosis among all ovarian carcinoma histotypes when diagnosed at advanced stage, because of the lack of effective therapy. IGF2BP3 is an RNA binding protein that
Yonglei Liu et al.
Journal of cellular and molecular medicine, 21(9), 1979-1988 (2017-05-20)
CD44, a cell adhesion protein, involves in various process in cancer such as cell survival and metastasis. Most researches on CD44 in cancer focus on cancer cells. Recently, it is found that CD44 expression is high in fibroblasts of tumour
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico