Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU105821

Sigma-Aldrich

MISSION® esiRNA

targeting human MST1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCAGTAGCCAAGATGGTGTGTGGGCCCTCAGGCTCCCAGCTTGTCCTGCTCAAGCTGGAGAGATCTGTGACCCTGAACCAGCGTGTGGCCCTGATCTGCCTGCCCCCTGAATGGTATGTGGTGCCTCCAGGGACCAAGTGTGAGATTGCAGGCTGGGGTGAGACCAAAGGTACGGGTAATGACACAGTCCTAAATGTGGCCTTGCTGAATGTCATCTCCAACCAGGAGTGTAACATCAAGCACCGAGGACGTGTGCGGGAGAGTGAGATGTGCACTGAGGGACTGTTGGCCCCTGTGGGGGCCTGTGAGGGTGACTACGGGGGCCCACTTGCCTGCTTTACCCACAACTGCTGGGTCCTGGAAGGAATTATAATCCCCAACCGAGTATGCGCAAGGTCCCGCTGGCCAGCTGTCTTCACGCGTGTCTCTGTGT

Ensembl | human accession no.

ENSG00000173531

NCBI accession no.

NM_020998

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MST1(4485) , MST1(4485)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Trang Nguyen-Vu et al.
Breast cancer research : BCR, 15(3), R51-R51 (2013-07-03)
Liver × receptors (LXRs) are members of the nuclear receptor family of ligand-dependent transcription factors and have established functions as regulators of cholesterol, glucose, and fatty acid metabolism and inflammatory responses. Published reports of anti-proliferative effects of synthetic LXR ligands
Li Chen et al.
International journal of clinical and experimental pathology, 8(9), 10545-10554 (2015-12-01)
E2F transcription factors regulate a wide range of biological processes, including cell cycle, apoptosis and DNA damage response. In the present study, we examined whether E2F2 is related to the poor prognosis of NSCLC and its role in progress of
Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Shiguan Wang et al.
Arthritis research & therapy, 20(1), 225-225 (2018-10-06)
Expression of E2F transcription factor 2 (E2F2), a transcription factor related to the cell cycle, is abnormally high in rheumatoid arthritis synovial fibroblasts (RASFs). Deregulated expression of E2F2 leads to abnormal production of proinflammatory cytokines, such as interleukin (IL)-1α, IL-1β
Hang Song et al.
Journal of physiology and biochemistry, 72(4), 733-744 (2016-08-16)
Glioblastoma multiforme (GBM), the most common and lethal primary brain tumor in adults characterized by high proliferative ability and mortality rate, contains a small subpopulation of cancer stem-like cells (CSCs), which is responsible for GBM progression and therapeutic resistance. Numerous
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico