Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU094041

Sigma-Aldrich

MISSION® esiRNA

targeting human MLXIPL

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío07 de abril de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío07 de abril de 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCTCTTCTCTCCCAGGTTTCCCTTCCCCACCGTCCCTCCTGCCCCAGGAGTGTCTCCGCTGCCTGCTCCTGCAGCCTTCCCACCCACCCCACAGTCTGTCCCCAGCCCAGCCCCCACCCCCTTCCCCATAGAGCTTCTACCCTTGGGGTATTCGGAGCCTGCCTTTGGGCCTTGCTTCTCCATGCCCAGAGGCAAGCCCCCCGCCCCATCCCCTAGGGGACAGAAAGCCAGCCCCCCTACCTTAGCCCCTGCCACTGCCAGTCCCCCCACCACTGCGGGGAGCAACAACCCCTGCCTCACACAGCTGCTCACAGCAGCTAAGCCGGAGCAAGCCCTGGAGCCACCACTTGTATCCAGCACCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Susumu Suzuki et al.
Endocrine journal, 67(3), 335-345 (2019-12-10)
Carbohydrate response element binding protein (ChREBP), a glucose responsive transcription factor, mainly regulates expression of genes involved in glucose metabolism and lipogenesis. Recently, ChREBP is speculated to be involved in the onset and progression of diabetic nephropathy (DN). However, there
Nan Chen et al.
Journal of cellular physiology, 236(1), 625-640 (2020-06-26)
Lipid deposition caused by the disorder of renal lipid metabolism is involved in diabetic nephropathy (DN). Carbohydrate response element-binding protein (ChREBP) is a key transcription factor in high glucose-induced cellular fat synthesis. At present, the regulation and mechanism of ChREBP
Can Cai et al.
International journal of molecular medicine, 42(3), 1215-1228 (2018-05-23)
Non‑alcoholic fatty liver disease (NAFLD) is a manifestation of metabolic syndrome in the liver and is closely associated with diabetes; however, its pathogenesis remains to be elucidated. Carbohydrate responsive element binding protein (ChREBP), the hub of glucolipid metabolism, regulates the

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico