Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU020151

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCA

Ensembl | human accession no.

ENSG00000168615

NCBI accession no.

NM_003816

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADAM9(8754) , ADAM9(8754)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui Zhou et al.
Frontiers in medicine, 7, 214-214 (2020-07-09)
Upregulation of a disintegrin and metalloprotease 9 (ADAM9) is correlated with progression of cancers, such as prostate, bladder, and pancreatic cancers. However, its role in triple-negative breast cancer (TNBC) is still unclear. Our study aimed to investigate whether ADAM9 is
Jun Arai et al.
Journal of gastroenterology and hepatology, 33(5), 1075-1081 (2017-10-22)
The multi-kinase inhibitor regorafenib (REG) was recently demonstrated to be effective in patients with sorafenib (SOR)-resistant hepatocellular carcinoma (HCC). Interestingly, SOR is known to enhance the accumulation of membrane-bound MHC class I polypeptide-related sequence A (mMICA) in HCC cells and
Mari Ueno et al.
Cancer science, 109(2), 471-482 (2017-12-17)
ADAMs (a disintegrin and metalloproteinases) are involved in various biological events such as cell adhesion, migration and invasion, membrane protein shedding and proteolysis. However, there have been no systematic studies on the expression of ADAMs in human ovarian carcinomas. We
Jun Arai et al.
Cancer immunology, immunotherapy : CII, 70(1), 203-213 (2020-07-20)
In our previous genome-wide association study, we demonstrated the association between MHC class I-related chain A (MICA) and hepatocellular carcinoma (HCC) development in patients with chronic hepatitis C. Increasing membrane-bound MICA (mMICA) in cancer cells by reducing MICA sheddases facilitates
Liang Chang et al.
Molecular medicine reports, 12(1), 1197-1204 (2015-03-18)
A disintegrin and metalloproteinase 9 (ADAM9) is a type I transmembrane protein that has been associated with cancer development and metastasis in various types of cancer. However, little is known about its role in non-small cell lung cancer (NSCLC). The
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico