Skip to Content
Merck
All Photos(1)

Key Documents

EMU074771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2l11

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGGAGACGAGTTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGGTTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGACAGGATCTACATGCAGCCAGGATACGTGGCGGACATGGCTCTTGTTCAGACTGGGAGAACCCCCACGCGTCATGTCCCTCTCTTGGTGCTGCGACAGTGTGTCCAGTGGTTCTATCCCAGAGAGATGTGCTGAGCATGGACAGCGCTCTGCACTGTGTCGATGTGAACGGAACCTCTGTTCATCACCACATGGCCGAGTTTTCAGTAAATATTTGTTGTGAATGTAAACAAGGGAGGGCTTTTCTCTTTTTAATGTACAGATCCTAGGAACAGAGAAATATGCAAGAGAGGTGTTTACATGTGGCGTG

Ensembl | mouse accession no.

ENSMUSG00000027381

NCBI accession no.

NP_997563

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... BCL2L11(12125) , Bcl2l11(12125)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oluwafunmilayo F Lamidi et al.
Journal of cancer research and clinical oncology, 141(9), 1575-1583 (2015-01-31)
Tubulysins are natural tetrapeptides that inhibit tubulin polymerisation. Tubulysins are very potent inhibitors of mammalian cancer cell growth, but restricted availability has limited their characterisation and development as anti-cancer compounds. KEMTUB10 was recently developed as a synthetic analogue of natural
Gong-Quan Li et al.
Oncotarget, 7(3), 2462-2474 (2015-11-18)
Bromodomain 4 (BRD4) is an epigenetic regulator that, when inhibited, has anti-cancer effects. In this study, we investigated whether BRD4 could be a target for treatment of human hepatocellular carcinoma (HCC). We show that BRD4 is over-expressed in HCC tissues.
S L Locatelli et al.
Leukemia, 28(9), 1861-1871 (2014-02-25)
Relapsed/refractory Hodgkin's lymphoma (HL) is an unmet medical need requiring new therapeutic options. Interactions between the histone deacetylase inhibitor Givinostat and the RAF/MEK/ERK inhibitor Sorafenib were examined in HDLM-2 and L-540 HL cell lines. Exposure to Givinostat/Sorafenib induced a synergistic
Anja Heinemann et al.
Oncotarget, 6(25), 21507-21521 (2015-06-19)
Histone acetylation marks have an important role in controlling gene expression and are removed by histone deacetylases (HDACs). These marks are read by bromodomain and extra-terminal (BET) proteins and novel inhibitiors of these proteins are currently in clinical development. Inhibitors
Lin Deng et al.
The Journal of general virology, 96(9), 2670-2683 (2015-08-25)
We previously reported that hepatitis C virus (HCV) infection induces Bax-triggered, mitochondrion-mediated apoptosis by using the HCV J6/JFH1 strain and Huh-7.5 cells. However, it was still unclear how HCV-induced Bax activation. In this study, we showed that the HCV-induced activation
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service