Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU009531

Sigma-Aldrich

MISSION® esiRNA

targeting human PLA2G4A

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGCCTTGGTGAGTGATTCAGCTTTATTCAATACCAGAGAAGGACGTGCTGGGAAGGTACACAACTTCATGCTGGGCTTGAATCTCAATACATCTTATCCACTGTCTCCTTTGAGTGACTTTGCCACACAGGACTCCTTTGATGATGATGAACTGGATGCAGCTGTAGCAGATCCTGATGAATTTGAGCGAATATATGAGCCTCTGGATGTCAAAAGTAAAAAGATTCATGTAGTGGACAGTGGGCTCACATTTAACCTGCCGTATCCCTTGATACTGAGACCTCAGAGAGGGGTTGATCTCATAATCTCCTTTGACTTTTCTGCAAGGCCAAGTGACTCTAGTCCTCCGTTCAAGGAACTTCTACTTGCAGAAAAGTGGGCTAAAATGAACAAGCTCCCCTTTCCAAAGATTGATCCTTATGTGTTTGATCGGGAAGGGCTGAAGGAGTGCTATGTCTTTAAACCCAAGAATCCTGATATGGAGAAAGATTGCCCAACCATCATCCACTTTGTTCTGGCCAACATCA

Ensembl | human accession no.

ENSG00000116711

NCBI accession no.

NM_024420

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PLA2G4A(5321) , PLA2G4A(5321)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chinmoy Sarkar et al.
Autophagy, 16(3), 466-485 (2019-06-27)
Lysosomal membrane permeabilization (LMP) is observed under many pathological conditions, leading to cellular dysfunction and death. However, the mechanisms by which lysosomal membranes become leaky in vivo are not clear. Our data demonstrate that LMP occurs in neurons following controlled
Nikos Koundouros et al.
Cell, 181(7), 1596-1611 (2020-06-20)
Oncogenic transformation is associated with profound changes in cellular metabolism, but whether tracking these can improve disease stratification or influence therapy decision-making is largely unknown. Using the iKnife to sample the aerosol of cauterized specimens, we demonstrate a new mode
Dennis Y Chuang et al.
Journal of neuroinflammation, 12, 199-199 (2015-11-02)
Oxidative stress and inflammation are important factors contributing to the pathophysiology of numerous neurological disorders, including Alzheimer's disease, Parkinson's disease, acute stroke, and infections of the brain. There is well-established evidence that proinflammatory cytokines and glutamate, as well as reactive

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service