Skip to Content
Merck
All Photos(1)

Documents

EMU047871

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCCACGGTACTTCCTTCTGAAGAGTGATGGATCTTTCATTGGGTATAAGGAGAGGCCCGAGGCCCCTGACCAGACCTTACCCCCCCTGAACAATTTCTCTGTAGCAGAATGCCAGCTGATGAAGACTGAGAGGCCACGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATCGAGAGGACCTTCCATGTAGACTCTCCAGATGAGAGGGAAGAGTGGATGCGGGCTATCCAGATGGTCGCCAACAGTCTGAAGCAGCGGGGCCCAGGTGAGGACGCCATGGATTACAAGTGTGGCTCCCCCAGTGACTCTTCCACATCTGAGATGATGGAGGTAGCTGTCAACAAGGCACGGGCCAAAGTGACCATGAATGACTTCGATTATCTCAAACTCCTCGGCAAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they
Samir Attoub et al.
Scientific reports, 5, 12759-12759 (2015-08-04)
The Akt/PKB serine/threonine protein kinase consists of three isoforms: Akt-1, -2 and -3. Their overexpression has been detected in human cancers, but their roles in cancer progression are unclear. We investigated the impact of specific silencing of Akt1 and Akt2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service