Skip to Content
Merck
All Photos(1)

Key Documents

EHU086641

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC12A9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGAACACACTGGCTGCTGTGGTCACTGTCTTCTACCTGGTGGCCTATGCTGCCGTGGACCTGTCCTGCCTGAGCCTGGAGTGGGCCTCGGCCCCCAACTTCCGCCCCACCTTCAGCCTGTTCTCCTGGCACACCTGCCTGCTGGGGGTGGCCTCCTGCCTGCTCATGATGTTCCTCATCAGTCCTGGCGCGGCTGGTGGCTCCCTGCTCCTCATGGGTCTGCTGGCTGCCCTGCTCACCGCGCGAGGAGGCCCCAGTAGCTGGGGCTATGTCAGCCAGGCCTTGCTTTTCCACCAGGTGCGTAAGTATCTGCTTCGGCTGGACGTCCGGAAGGATCACGTGAAGTTCTGGCGGCCCCAGCTGCTGCTCCTGGTGGGGAACCCCCGGGGCGCCCTGCCTCTGCTGCGGTTGGCCAACCAGCTTAAGAAGGGG

Ensembl | human accession no.

ENSG00000146828

NCBI accession no.

NM_020246

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC12A9(56996) , SLC12A9(56996)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anna E Vilgelm et al.
EBioMedicine, 24, 43-55 (2017-10-17)
Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service