콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU090501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nsg1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGGTGTCACCGAGAGGTTTAAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAGTGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTACAACGTGGCCAAGCAGAGCATCACCCGCTCCGTGTCGCCATGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCGGAACAGGAGACCGAAGCTGCAGAGAAGTCAGCTTAGCGAGCAGGGCAGGTTCCTTACGATGTGTCACTTGAAGGCAACAAGGGGACTTTGAGGGACATTTCATTAAATATAATTACCGATAATTTAGAGATTACTCATTTACGGTGCAATTGCTTCTGTTTGCTAATGCTGCTTTGCAAATTAAACTTGCTGCGGACCACCCACAGGCGTAAGAACAAGAGCATCTCAGCATTGCTTAGAGAGCTGGATGCCACTGTCCACGCTGAGGAGTCTTC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Purusottam Mohapatra et al.
The international journal of biochemistry & cell biology, 66, 75-84 (2015-07-28)
Combination therapy using two or more small molecule inhibitors of aberrant signaling cascade in aggressive breast cancers is a promising therapeutic strategy over traditional monotherapeutic approaches. Here, we have studied the synergistic mechanism of resveratrol and curcumin induced apoptosis using
Daqian Wan et al.
Anti-cancer drugs, 26(9), 931-941 (2015-07-17)
Aspidin PB is a natural product extracted from Dryopteris fragrans (L.) Schott, which has been characterized for its various biological activities. We reported that aspidin PB induced cell cycle arrest and apoptosis through the p53/p21 and mitochondria-dependent pathways in human
Koichi Shoji et al.
Oncology reports, 32(1), 65-70 (2014-05-21)
Fibroblast growth factor receptor 2 (FGFR2) is thought to mediate an important signaling pathway between prostate epithelial cells and stromal cells for maintenance of homeostasis in normal prostate tissue. Abnormalities of FGFR2 have been shown in advanced prostate cancer or
Haizhi Huang et al.
Journal of functional foods, 15, 464-475 (2015-06-27)
Galangin and myricetin are flavonoids isolated from vegetables and fruits which exhibit anti-proliferative activity in human cancer cells. In this study, their anti-angiogenic effects were investigated with
Malte Kriegs et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 115(1), 120-127 (2015-03-23)
How EGF receptor (EGFR) inhibition induces cellular radiosensitization and with that increase in tumor control is still a matter of discussion. Since EGFR predominantly regulates cell cycle and proliferation, we studied whether a G1-arrest caused by EGFR inhibition may contribute

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.