콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU043441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hspa2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGCAGACGCAGACCTTCACTACCTACTCAGACAACCAGAGCAGCGTGCTGGTGCAAGTGTACGAGGGCGAACGGGCCATGACCAAGGACAATAACCTCTTGGGCAAGTTCGACCTGACTGGGATCCCCCCAGCACCCCGTGGGGTCCCCCAGATCGAGGTCACCTTTGACATCGATGCCAACGGCATCCTTAACGTCACTGCTGCCGACAAGAGCACCGGTAAAGAAAATAAAATCACCATAACCAACGACAAGGGTCGGCTGAGCAAAGACGACATTGACCGGATGGTGCAGGAGGCGGAGCGGTACAAATCGGAAGATGAAGCAAATCGCGATCGCGTGGCAGCCAAAAATGCGGTGGAGTCCTATACCTACAACATCAAGCAGACCGTGGAAGACGAGAAACTGAGGGGCAAGATTAGCGAGCAGGACAAAAACAAGATCCTCGACAAGTGTCAGGAGGTGATCAACTGGCTTGACCGAAACCAGATGGCAGAGAAAGATGAGTACGAACACAAGCAGAAAGAGCTTGAGAGAGTGTGCAACCCCAT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Kanika Jain et al.
Cell stress & chaperones, 19(6), 801-812 (2014-03-05)
The fall in ambient oxygen pressure in high-altitude milieu elicits a wide range of physiological responses in the myocardium, which may differ from individual to individual. This condition, known as hypobaric hypoxia, invokes the cardioprotective heat shock response. The present
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.