콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU011661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Icam1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGTACATACGTGTGCCATGCCTTTAGCTCCCATGGGAATGTCACCAGGAATGTGTACCTGACAGTACTGTACCACTCTCAAAATAACTGGACTATAATCATTCTGGTGCCAGTACTGCTGGTCATTGTGGGCCTCGTGATGGCAGCCTCTTATGTTTATAACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGGAGGAGGCCATAAAACTCAAGGGACAAGCCCCACCTCCCTGAGCCTGCTGGATGAGACTCCTGCCTGGACCCCCTGCAGGGCAACAGCTGCTGCTGCTTTTGAACAGAATGGTAGACAGCATTTACCCTCAGCCACTTCCTCTGGCTGTCACAGAACAGGATGGTGGCCTGGGGGATGCACACTTGTAGCCTCAGAGCTAAGAGGACTCGGTGGATGG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Weibao Xiao et al.
Experimental eye research, 138, 145-152 (2015-07-19)
FTY720 is a promising drug in attenuating multiple sclerosis, prolonging survival of organ allograft, and many other protective effects. Its mechanism of action is considered to be mediated by the internalization of sphingosine 1-phosphate receptors (S1PRs). In the current study
Chunhua Jin et al.
Molecular medicine (Cambridge, Mass.), 20, 280-289 (2014-06-12)
The myocardial inflammatory response contributes to cardiac functional injury associated with heart surgery obligating global ischemia/reperfusion (I/R). Toll-like receptors (TLRs) play an important role in the mechanism underlying myocardial I/R injury. The aim of this study was to examine the
Fumitake Ito et al.
The Journal of clinical endocrinology and metabolism, 99(6), 2188-2197 (2014-03-13)
Monocyte adhesion to endothelial cells is an important initial event in atherosclerosis and is partially mediated by adhesion molecule expression on the cell surface. Although estrogens inhibit atherosclerosis development, effects of coadministered progestogen remain controversial. We examined the effects of
Shiro Koizume et al.
Molecular cancer, 14, 77-77 (2015-04-17)
Elucidation of the molecular mechanisms by which cancer cells overcome hypoxia is potentially important for targeted therapy. Complexation of hypoxia-inducible factors (HIFs) with aryl hydrocarbon receptor nuclear translocators can enhance gene expression and initiate cellular responses to hypoxia. However, multiple
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 309(1), E35-E44 (2015-05-07)
Obesity is associated with inflammation and immune cell recruitment to adipose tissue, muscle and intima of atherosclerotic blood vessels. Obesity and hyperlipidemia are also associated with tissue insulin resistance and can compromise insulin delivery to muscle. The muscle/fat microvascular endothelium

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.