콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU011371

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATGGCCAACTCGTTTGTAGGGACGCGCTCCTACATGTCCCCAGAGCGGCTGCAGGGCACCCACTACTCTGTGCAGTCGGACATCTGGAGCATGGGGCTGTCGCTGGTGGAGCTGGCCATCGGGAGGTATCCCATTCCCCCACCTGATGCCAAGGAACTAGAGGCCAGCTTTGGCCGGCCTGTGGTGGACGGGGCAGACGGAGAACCCCATAGTGTCTCCCCGAGGCCCAGGCCCCCTGGACGCCCCATCAGTGTAGGTCATGGGATGGACAGCCGACCGGCCATGGCCATCTTTGAGCTGCTGGACTACATAGTGAACGAGCCACCTCCCAAGCTGCCCAGTGGTGTGTTCAGCTCAGACTTCCAGGAGTTTGTGAATAAATGTCTCATTAAGAACCCAGCAGAGCGAGCAGATCTGAAGC

Ensembl | 마우스 수납 번호

ENSMUSG00000035027

NCBI 수납 번호

NM_023138

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... MAP2K2(26396) , Map2k2(26396)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sara Alves et al.
Oncotarget, 6(31), 30787-30802 (2015-09-30)
The recent interest to modulate autophagy in cancer therapy has been hampered by the dual roles of this conserved catabolic process in cancer, highlighting the need for tailored approaches. Since RAS isoforms have been implicated in autophagy regulation and mutation
Simona Gargiulo et al.
International journal of molecular sciences, 13(11), 14278-14293 (2012-12-04)
The hypercholesterolemia-atherosclerosis association is now established; hypercholesterolemia may induce vascular-cell activation, subsequently increasing expression of adhesion molecules, cytokines, chemokines, growth factors, and other key inflammatory molecules. Among inflammatory molecules expressed by vascular cells, integrins play a critical role in regulating
Lei-Lei Chen et al.
Autophagy, 13(11), 1969-1980 (2017-09-22)
Recent studies have demonstrated that dysregulation of macroautophagy/autophagy may play a central role in the pathogenesis of neurodegenerative disorders, and the induction of autophagy protects against the toxic insults of aggregate-prone proteins by enhancing their clearance. Thus, autophagy has become
Caroline N Mills et al.
Molecular cancer, 8, 104-104 (2009-11-19)
Hypoxia inducible factor-1 alpha (HIF-1alpha) protein is rapidly degraded under normoxic conditions. When oxygen tensions fall HIF-1alpha protein stabilizes and transactivates genes involved in adaptation to hypoxic conditions. We have examined the normoxic expression of HIF-1alpha RNA and protein in
Kazutaka Nanba et al.
Endocrinology, 156(5), 1750-1756 (2015-02-14)
There is considerable evidence supporting the role of calcium signaling in adrenal regulation of both aldosterone synthase (CYP11B2) and aldosterone production. However, there have been no studies that investigated the role played by the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK) in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.