콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU131981

Sigma-Aldrich

MISSION® esiRNA

targeting human HBP1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CATTGGAGTTGCTGCAGTGTAATGAGAATTTGCCATCTTCACCTGGATATAACTCCTGTGATGAACACATGGAGCTTGATGACCTTCCTGAACTTCAGGCAGTTCAAAGTGATCCTACCCAATCTGGCATGTACCAGCTGAGTTCAGATGTTTCACATCAAGAATACCCAAGATCATCTTGGAACCAAAATACCTCAGACATACCAGAAACTACTTACCGTGAAAATGAGGTGGACTGGCTAACAGAATTGGCAAATATCGCGACCAGTCCACAAAGTCCACTGATGCAGTGCTCATTTTACAATAGATCATCTCCTGTACACATCATAGCCACTAGCAAAAGTTTACATTCCTATGCACGCCCTCCACCAGTGTCCTCTTCTTCGAAGAGTGAACCAGCCTTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhiyong Yan et al.
FEBS letters, 588(17), 3038-3046 (2014-06-17)
We found that miR-96 is overexpressed in glioma, and its level inversely correlates with the survival of patients. The reduction in miR-96 abundance suppresses the proliferation and colony formation of glioma cells. The tumorigenicity of U-87 MG cells is reduced
Z Z Yao et al.
Journal of biological regulators and homeostatic agents, 34(2), 357-366 (2020-06-19)
This study aims to explore the effect of p38 mitogen-activated protein kinase and its downstream target HMG-box transcription factor 1 (HBP1) in the chondrocyte (CH) senescence caused by hyperosmotic stress. Human cartilage tissue with or without osteoarthritis (OA) were collected
Ruo-Chia Tseng et al.
Journal of cellular and molecular medicine, 18(9), 1752-1761 (2014-06-05)
β-catenin nuclear accumulation is frequently identified in human non-small cell lung cancer (NSCLC). The HMG-box transcription factor 1 (HBP1) is a known repressor of β-catenin transactivation. However, the role of HBP1 in relation to β-catenin nuclear accumulation has not been

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.